Saltar al contenido
Merck

EHU010531

Sigma-Aldrich

MISSION® esiRNA

targeting human MMP9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTGACAGCGACAAGAAGTGGGGCTTCTGCCCGGACCAAGGATACAGTTTGTTCCTCGTGGCGGCGCATGAGTTCGGCCACGCGCTGGGCTTAGATCATTCCTCAGTGCCGGAGGCGCTCATGTACCCTATGTACCGCTTCACTGAGGGGCCCCCCTTGCATAAGGACGACGTGAATGGCATCCGGCACCTCTATGGTCCTCGCCCTGAACCTGAGCCACGGCCTCCAACCACCACCACACCGCAGCCCACGGCTCCCCCGACGGTCTGCCCCACCGGACCCCCCACTGTCCACCCCTCAGAGCGCCCCACAGCTGGCCCCACAGGTCCCCCCTCAGCTGGCCCCACAGGTCCCCCCACTGCTGGCCCTTCTACGGCCACTACTGTGCCTTTGAGTCCGGTGGACGATGCCTGCAACGTGAACATCTTCGACG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiaoli Wang et al.
Oncotarget, 8(47), 81880-81891 (2017-11-16)
Obesity is involved in tumor progression. However, the corresponding mechanisms remain largely unknown. Here, we report that adipocytes increase the invasive ability of tumor cells by producing exosomes with a high level of MMP3. Compared with 3T3-L1 cells, 3T3-L1 adipocytes
Xue Bai et al.
OncoTargets and therapy, 10, 2837-2847 (2017-06-28)
Epithelial-mesenchymal transition (EMT) is thought to be a crucial event during the early metastasis of tumor cells. Transforming growth factor (TGF)-β1 is involved in the process of EMT in a variety of human malignancies. Matrix metalloproteinase (MMP)-9 plays an important
Hang Lin et al.
FEBS open bio, 7(9), 1291-1301 (2017-09-15)
Dysregulation of sirtuin 6 (SIRT6) is actively involved in tumor progression. High levels of SIRT6 have been associated with hepatocellular carcinoma and non-small cell lung cancer, and SIRT6 facilitates growth and metastasis of cancer cells. However, the clinical significance and
Jon M Florence et al.
PloS one, 12(2), e0171427-e0171427 (2017-02-07)
The atherosclerotic process begins when vascular endothelial cells undergo pro-inflammatory changes such as aberrant activation to dysfunctional phenotypes and apoptosis, leading to loss of vascular integrity. Our laboratory has demonstrated that exposure of mice to second hand smoke triggers an
Haibin Lu et al.
American journal of translational research, 9(12), 5361-5374 (2018-01-10)
Tumor-associated neutrophils (TANs) promote metastasis of multiple cancers, including oral squamous cell carcinoma (OSCC). Melatonin (Mel) reportedly exerts anti-metastatic effects on OSCC. However, little is known about the anti-OSCC effects of Mel involved in TANs. In this study, intensive infiltration

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico