Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU010021

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGCTAGGGAACAGATGGACGTCGAGGAC

Ensembl | nº de acceso humano

ENSG00000179348

Nº de acceso NCBI

NM_032638

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... GATA2(2624) , GATA2(2624)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carole-Anne Whigham et al.
Scientific reports, 9(1), 235-235 (2019-01-20)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and organ injury. GATA2 is a transcription factor expressed in the endothelium which regulates vascular homeostasis by controlling transcription of genes and microRNAs, including
Siyan Chen et al.
Molecular immunology, 123, 32-39 (2020-05-16)
At present, most studies on the relationship between hepatitis B virus (HBV) and IL-33/ST2 axis focus on clinical detection, but the underlying molecular mechanisms of HBx and IL-33/ST2 axis regulation and Th cell function regulation have not been explored. In
Fuwen Yuan et al.
Nucleic acids research, 47(19), 10104-10114 (2019-09-11)
Enzalutamide, a second-generation androgen receptor (AR) antagonist, has demonstrated clinical benefit in men with prostate cancer. However, it only provides a temporary response and modest increase in survival, indicating a rapid evolution of resistance. Previous studies suggest that enzalutamide may
Cong Qiu et al.
Nature communications, 8, 15426-15426 (2017-06-02)
Data from clinical research and our previous study have suggested the potential involvement of SENP1, the major protease of post-translational SUMOylation, in cardiovascular disorders. Here, we investigate the role of SENP1-mediated SUMOylation in graft arteriosclerosis (GA), the major cause of
Mark A Gillespie et al.
Molecular cell, 78(5), 960-974 (2020-04-25)
Dynamic cellular processes such as differentiation are driven by changes in the abundances of transcription factors (TFs). However, despite years of studies, our knowledge about the protein copy number of TFs in the nucleus is limited. Here, by determining the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico