Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU009691

Sigma-Aldrich

MISSION® esiRNA

targeting human RND3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GTCGGCTGCAAGTCTGATCTGCGGACAGATGTTAGTACATTAGTAGAGCTCTCCAATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAAATATGGCCAAACAGATTGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAGAGACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTAAGCGGAACAAATCACAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCGGCAGTTGCTACGGACTTACGAAAGGACAAAGCGAAGAGCTGCACTGTGATGTGAATCTTTCATTATCTTTAATGAAGACAAAGGAATCTAGTGTAAAAAACAACAGCAAACAAAAAGGTGAAGTCTAAATGAAGTGCACAGCCAAAGTC

Ensembl | nº de acceso humano

ENSG00000115963

Nº de acceso NCBI

NM_005168

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... RND3(390) , RND3(390)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS
LGS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chen Jiang et al.
Cancer research, 80(10), 1957-1969 (2020-02-16)
Nasopharyngeal carcinoma is an Epstein-Barr virus (EBV)-related malignancy. Recently, we found that the EBV-encoded miRNA BART2-5p was increased in the serum of patients with preclinical nasopharyngeal carcinoma and that the copy number positively correlated with disease progression. In this study
Marta Hernández-Sánchez et al.
Oncotarget, 6(19), 17479-17490 (2015-06-04)
RhoE is a small GTPase involved in the regulation of actin cytoskeleton dynamics, cell cycle and apoptosis. The role of RhoE in cancer is currently controversial, with reports of both oncogenic and tumor-suppressive functions for RhoE. Using RhoE-deficient mice, we
Kim Clarke et al.
PLoS genetics, 11(7), e1005325-e1005325 (2015-07-02)
Gliomas are a highly heterogeneous group of brain tumours that are refractory to treatment, highly invasive and pro-angiogenic. Glioblastoma patients have an average survival time of less than 15 months. Understanding the molecular basis of different grades of glioma, from

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico