Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU009371

Sigma-Aldrich

MISSION® esiRNA

targeting human CENPJ

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCTCGAAGATCCAAGTCTGCACCTCCTCGTGATTTAGGCAATTTGGATAAGGGACAAGCTGCCTCTCCCAGGGAGCCACTTGAACCACTGAACTTCCCAGATCCTGAATATAAAGAGGAGGAGGAAGACCAAGACATACAGGGAGAAATCAGTCATCCTGATGGAAAGGTGGAAAAGGTTTATAAGAATGGGTGCCGTGTTATACTGTTTCCCAATGGAACTCGAAAGGAAGTGAGTGCAGATGGGAAGACCATCACTGTCACTTTCTTTAATGGTGACGTGAAGCAGGTCATGCCAGACCAAAGAGTGATCTACTACTATGCAGCTGCCCAGACCACTCACACGACATACCCGGAGGGACTGGAAGTCTTACATTTCTCAAGTGGACAAATAGAAAAACATTACCCAGATGGAAGAAAAGAAATCACGTTTCCTGACCAGACTGTTAAAAACTTATTTCCTGATGGACAAGAAGAAAGCATTTTCCCAGATGGTACAATTGTCAGAGTACAACGTGATGGCAACAAACT

Ensembl | nº de acceso humano

ENSG00000151849

Nº de acceso NCBI

NM_018451

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CENPJ(55835) , CENPJ(55835)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tao Xu et al.
Toxicology letters, 294, 177-183 (2018-05-21)
Alcohol can decrease cell proliferation in neural cells. The proliferation of neural cells can be inhibited by the asymmetric division of neural progenitor cells. However, whether alcohol inhibits cell proliferation through inducing cell asymmetric division is not yet clear. Here
Patricia P Garcez et al.
Nature communications, 6, 6474-6474 (2015-03-11)
The proneural factor Ascl1 controls multiple steps of neurogenesis in the embryonic brain, including progenitor division and neuronal migration. Here we show that Cenpj, also known as CPAP, a microcephaly gene, is a transcriptional target of Ascl1 in the embryonic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico