Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU009051

Sigma-Aldrich

MISSION® esiRNA

targeting human DDIT4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTACTGCGCCTGGCCTACAGCGAGCCGTGCGGCCTGCGGGGGGCGCTGCTGGACGTCTGCGTGGAGCAGGGCAAGAGCTGCCACAGCGTGGGCCAGCTGGCACTCGACCCCAGCCTGGTGCCCACCTTCCAGCTGACCCTCGTGCTGCGCCTGGACTCACGACTCTGGCCCAAGATCCAGGGGCTGTTTAGCTCCGCCAACTCTCCCTTCCTCCCTGGCTTCAGCCAGTCCCTGACGCTGAGCACTGGCTTCCGAGTCATCAAGAAGAAGCTGTACAGCTCGGAACAGCTGCTCATTGAGGAGTGTTGAACTTCAACCTGAGGGGGCCGACAGTGCCCTCCAAGACAGAGACGACTGAACTTTTGGGGTGGAGACTAGAGGCAGGAGCTGAGGGACTGATTCCTGTGGTTGGAAAACTGAGGCAGCCACCTAA

Ensembl | nº de acceso humano

ENSG00000168209

Nº de acceso NCBI

NM_019058

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... DDIT4(54541) , DDIT4(54541)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Oscar Alvarez-Garcia et al.
Arthritis & rheumatology (Hoboken, N.J.), 69(7), 1418-1428 (2017-03-24)
Regulated in development and DNA damage response 1 (REDD1) is an endogenous inhibitor of mechanistic target of rapamycin (mTOR) that regulates cellular stress responses. REDD1 expression is decreased in aged and osteoarthritic (OA) cartilage, and it regulates mTOR signaling and
Bowen Wang et al.
Investigative ophthalmology & visual science, 60(8), 2836-2847 (2019-07-03)
To assess how DNA damage-inducible transcript 4 (DDIT4) and autophagic flux are altered in dry eye disease and reveal the underlying mechanisms. C57BL/6 mice were exposed to desiccating stress (subcutaneous scopolamine [0.5 mg/0.2 mL] 3 times a day, humidity <
Alexandra M Stevens et al.
Blood advances, 3(24), 4215-4227 (2019-12-20)
Atovaquone, a US Food and Drug Administration-approved antiparasitic drug previously shown to reduce interleukin-6/STAT3 signaling in myeloma cells, is well tolerated, and plasma concentrations of 40 to 80 µM have been achieved with pediatric and adult dosing. We conducted preclinical
Shu Wang et al.
Molecular cancer therapeutics, 14(4), 877-888 (2015-01-24)
We previously reported that a pan-PAD inhibitor, YW3-56, activates p53 target genes to inhibit cancer growth. However, the p53-independent anticancer activity and molecular mechanisms of YW3-56 remain largely elusive. Here, gene expression analyses found that ATF4 target genes involved in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico