Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU009041

Sigma-Aldrich

MISSION® esiRNA

targeting human FIGN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGCTCTGACAAACAGTTCAGCAAGTTCTCTCAAAAGGAAAGCTTTCTACATGGCAGGGCAAGGAGATATGGACTCCAGTTATGGAAATTACAGCTATGGCCAACAGAGATCTACACAGAGTCCTATGTACAGAATGCCCGACAACAGCATTTCAAACACAAATCGGGGGAATGGCTTTGACAGAAGTGCTGAAACATCATCCTTAGCATTTAAGCCAACGAAGCAGCTAATGTCCTCTGAACAGCAAAGGAAATTCAGCAGCCAGTCCAGTAGGGCTCTGACCCCTCCTTCCTACAGTACTGCTAAAAATTCATTGGGATCAAGATCCAGTGAATCCTTTGGGAAGTACACATCGCCAGTAATGAGTGAGCATGGGGACGAGCACAGGCAGCTCCTCTCTCACCCAATGCAAGGCCCTGGACTCCGTGCAGCTACCTCATCCAACCACTCTGTGGACGAGCAACTGAAGAATACTGACACGCACCTCATCGACCTGGTAACCAATGAGATTATCACCCAAGGACCTCCAG

Ensembl | nº de acceso humano

ENSG00000182263

Nº de acceso NCBI

NM_018086

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FIGN(55137) , FIGN(55137)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Xiaolong Yuan et al.
Genes, 9(6) (2018-06-15)
Previous studies suggest that signal transducer and activator of transcription 3 (STAT3) and CCAAT/enhancer binding protein beta (C/EBPβ) play an essential role in ovarian granulosa cells (GCs) for mammalian follicular development. Several C/EBPβ putative binding sites were previously predicted on
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Jian-Ming Lü et al.
International journal of molecular sciences, 20(2) (2019-01-16)
We have previously shown that ritonavir (RTV), a highly active anti-retroviral therapy (HAART) drug, can cause endothelial dysfunction through oxidative stress. Several antioxidants including ginsenoside Rb1, a compound with antioxidant effect, can effectively block this side effect of RTV in
Venkata Viswanadh Edara et al.
Biomedicines, 8(11) (2020-11-12)
Reactive astrogliosis is prominent in most neurodegenerative disorders and is often associated with neuroinflammation. The molecular mechanisms regulating astrocyte-linked neuropathogenesis during injury, aging and human immunodeficiency virus (HIV)-associated neurocognitive disorders (HAND) are not fully understood. In this study, we investigated
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico