Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU008921

Sigma-Aldrich

MISSION® esiRNA

targeting human MARCH5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCTGCAGCAGGAATAATGGTCGGCTCTATCTATTGGACAGCTGTGACTTATGGAGCAGTGACAGTGATGCAGGTTGTAGGTCATAAAGAAGGTCTGGATGTTATGGAGAGAGCTGATCCTTTATTCCTTTTAATTGGACTTCCTACTATTCCTGTCATGCTGATATTAGGCAAGATGATTCGCTGGGAGGACTATGTGCTTAGACTGTGGCGCAAATACTCGAATAAACTACAAATTTTAAATAGTATATTTCCAGGGATAGGTTGTCCTGTTCCTCGAATTCCAGCTGAGGCCAATCCTTTAGCAGATCATGTCTCTGCTACTCGAATCTTGTGTGGAGCCCTTGTCTTTCCTACTATTGCTACAATAGTTGGTAAATTGATGTTCAGTAGTGTTAACTCTAATTTACAAAGGACAATCTTGGGTGGAATTGC

Ensembl | nº de acceso humano

ENSG00000198060

Nº de acceso NCBI

NM_017824

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MARCH5(54708) , MARCH5(54708)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Linhe Lu et al.
Clinical and translational medicine, 10(5), e166-e166 (2020-10-01)
Myocardial ischemia/reperfusion (MI/R) injury imposes devastating cardiovascular sequelae in particular cardiac dysfunction as a result of restored blood flow. However, the mechanism behind MI/R injury remains elusive. Mitochondrial ubiquitin ligase (MITOL/MARCH5) is localized at the mitochondria-ER contact site and may
Young-Suk Yoo et al.
Nature communications, 6, 7910-7910 (2015-08-08)
Mitochondria serve as platforms for innate immunity. The mitochondrial antiviral signalling (MAVS) protein forms aggregates that elicit robust type-I interferon induction on viral infection, but persistent MAVS signalling leads to host immunopathology; it remains unknown how these signalling aggregates are

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico