Saltar al contenido
Merck

EHU008741

Sigma-Aldrich

MISSION® esiRNA

targeting human PLXNA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGTGGAGAAGTCGCTGACACTGTTCGGGCAGCTGCTGACCAAGAAGCACTTCCTGCTGACCTTCATCCGCACGCTGGAGGCACAGCGCAGCTTCTCCATGCGCGACCGCGGGAATGTGGCCTCGCTCATCATGACGGCCCTGCAGGGCGAGATGGAATACGCCACAGGCGTGCTCAAGCAGCTGCTTTCCGACCTCATCGAGAAGAACCTGGAGAGCAAGAACCACCCCAAGCTGCTACTGCGCCGGACTGAGTCGGTGGCAGAGAAGATGCTAACTAACTGGTTCACCTTCCTCTTGTATAAGTTCCTCAAGGAGTGCGCTGGGGAGCCGCTGTTCATGCTGTACTGCGCCATCAAGCAGCAGATGGAGAAGGGCCCCATTGACGCCATCACGGGTGAGGCACGCTACTCCCTGAGTGAGGACAAGCTCATCCG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei-Wei Wang et al.
EBioMedicine, 46, 66-78 (2019-08-07)
MicroRNAs (miRNAs) are involved in oncogenesis of esophageal squamous cell carcinoma (ESCC). miR-134 is reported to have a tumour-suppressive role but its role in ESCC is not known. The present study was designed to examine whether miR-134 inhibits ESCC development
Jason R Dobson et al.
Cancer cell international, 14, 73-73 (2014-08-15)
For treatment and prevention of metastatic disease, one of the premier challenges is the identification of pathways and proteins to target for clinical intervention. Micro RNAs (miRNAs) are short, non-coding RNAs, which regulate cellular activities by either mRNA degradation or

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico