Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU007771

Sigma-Aldrich

MISSION® esiRNA

targeting human IKBKB

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAAGAATTCCATGGCTTCCATGTCTCAGCAGCTCAAGGCCAAGTTGGATTTCTTCAAAACCAGCATCCAGATTGACCTGGAGAAGTACAGCGAGCAAACCGAGTTTGGGATCACATCAGATAAACTGCTGCTGGCCTGGAGGGAAATGGAGCAGGCTGTGGAGCTCTGTGGGCGGGAGAACGAAGTGAAACTCCTGGTAGAACGGATGATGGCTCTGCAGACCGACATTGTGGACTTACAGAGGAGCCCCATGGGCCGGAAGCAGGGGGGAACGCTGGACGACCTAGAGGAGCAAGCAAGGGAGCTGTACAGGAGACTAAGGGAAAAACCTCGAGACCAGCGAACTGAGGGTGACAGTCAGGAAATGGTACGGCTGCTGCTTCAGGCAATTCAGAGCTTCGAGAAGAAAGTGCGAGTGATCTATACGCAGCTCAGTAAAACTGTGGTTTGCAAGCAGAAGGCGCTGGAACTGTTGCCCAAGGTGGAAGAGGTGGTGAGCTTAATGAATGAGGATGAGAAGACTGTTGTCCGGCTG

Ensembl | nº de acceso humano

ENSG00000104365

Nº de acceso NCBI

NM_001556

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IKBKB(3551) , IKBKB(3551)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hae-Ki Min et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 30(12), 4071-4082 (2016-08-25)
IGF-binding protein-3 (IGFBP-3) is a liver-derived, anti-inflammatory molecule that is decreased in obesity, a key risk factor for nonalcoholic fatty liver disease (NAFLD). It was not known whether IGFBP-3 levels were altered in NAFLD, whether such alterations could be the
Peter O Oladimeji et al.
Biochemical pharmacology, 160, 92-109 (2018-12-20)
The pregnane X receptor (PXR) is a principal xenobiotic receptor crucial in the detection, detoxification, and clearance of toxic substances from the body. PXR plays a vital role in the metabolism and disposition of drugs, and elevated PXR levels contribute to cancer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico