Saltar al contenido
Merck

EHU007551

Sigma-Aldrich

MISSION® esiRNA

targeting human LCN2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Se-Lim Kim et al.
Cancer science, 108(11), 2176-2186 (2017-09-01)
Lipocalin 2 (LCN2), a member of the lipocalin superfamily, plays an important role in oncogenesis and progression in various types of cancer. However, the expression pattern and functional role of LCN2 in colorectal cancer (CRC) is still poorly understood. The
Masafumi Okuda et al.
Oncotarget, 8(21), 34670-34677 (2017-04-15)
Esophageal cancer is the eighth most common cancer and the sixth most common cause of cancer-related deaths worldwide. Despite the research progress in understanding the disease, the mechanism underlying the metastasis is still unclear. Here, we successfully generated a highly
Bilge Ören et al.
The Journal of pathology, 239(3), 274-285 (2016-04-03)
Tumour cell-secreted factors skew infiltrating immune cells towards a tumour-supporting phenotype, expressing pro-tumourigenic mediators. However, the influence of lipocalin-2 (Lcn2) on the metastatic cascade in the tumour micro-environment is still not clearly defined. Here, we explored the role of stroma-derived
Peng Guo et al.
Theranostics, 6(1), 1-13 (2016-01-02)
Lipocalin 2 (Lcn2) is a promising therapeutic target as well as a potential diagnostic biomarker for breast cancer. It has been previously shown to promote breast cancer progression by inducing the epithelial to mesenchymal transition in breast cancer cells as

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico