Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU006131

Sigma-Aldrich

MISSION® esiRNA

targeting human FBXL20

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACTGCCCTGAACTGGTGACTTTGAACTTGCAGACTTGCTTGCAAATCACAGATGAAGGTCTCATTACTATATGCAGAGGGTGCCATAAGTTACAATCCCTTTGTGCCTCTGGCTGCTCCAACATCACAGATGCCATCCTGAATGCTCTAGGTCAGAACTGCCCACGGCTTAGAATATTGGAAGTGGCAAGATGTTCTCAATTAACAGATGTGGGCTTTACCACTCTAGCCAGGAATTGCCATGAACTTGAAAAGATGGACCTGGAAGAGTGTGTTCAGATAACAGATAGCACATTAATCCAACTTTCTATACACTGTCCTCGACTTCAAGTATTGAGTCTGTCTCACTGTGAGCTGATCACAGATGATGGAATTCGTCACCTGGGGAATGGGGCCTGCGCCCATGACCAGCTGGAGGTGATTGAGCTGGACAACTGC

Ensembl | nº de acceso humano

ENSG00000108306

Nº de acceso NCBI

NM_032875

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FBXL20(84961) , FBXL20(84961)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Isabelle Tancioni et al.
Molecular cancer therapeutics, 13(8), 2050-2061 (2014-06-06)
Ovarian cancer ascites fluid contains matrix proteins that can impact tumor growth via integrin receptor binding. In human ovarian tumor tissue arrays, we find that activation of the cytoplasmic focal adhesion (FAK) tyrosine kinase parallels increased tumor stage, β5 integrin
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico