Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU006001

Sigma-Aldrich

MISSION® esiRNA

targeting human FANCF

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACCCAAATCTCCAGGAGGACTCTCTGATGAAGACCCAGGCGGAGCTGCTGCTGGAGCGTCTGCAGGAGGTGGGGAAGGCCGAAGCGGAGCGTCCCGCCAGGTTTCTCAGCAGCCTGTGGGAGCGCTTGCCTCAGAACAACTTCCTGAAGGTGATAGCGGTGGCGCTGTTGCAGCCGCCTTTGTCTCGTCGGCCCCAAGAAGAGTTGGAACCCGGCATCCACAAATCACCTGGAGAGGGGAGCCAAGTGCTAGTCCACTGGCTTCTGGGGAATTCGGAAGTCTTTGCTGCCTTTTGTCGCGCCCTCCCAGCCGGGCTTTTGACTTTAGTGACTAGCCGCCACCCAGCGCTGTCTCCTGTCTATCTGGGTCTGCTAACAGACTGGGGTCAACGTTTGCACTATGACCTTCAGAAAGGCATTTGGGTTGGAACTGAGTCC

Ensembl | nº de acceso humano

ENSG00000183161

Nº de acceso NCBI

NM_022725

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... FANCF(2188) , FANCF(2188)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
RBV
ACIU
OIU
JRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jiankun Yu et al.
Journal of breast cancer, 16(3), 291-299 (2013-10-25)
Fanconi anemia complementation group F (FANCF) is a key factor to maintaining the function of Fanconi anaemia/BRCA (FA/BRCA) pathway, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In the present study
Jiankun Yu et al.
International journal of nanomedicine, 11, 6651-6666 (2016-12-21)
Two different disulfide (SS)-containing poly(amidoamine) (PAA) polymers were constructed using guanidino (Gua)-containing monomers (ie, arginine [Arg] and agmatine [Agm]) and N,N'-cystamine bisacrylamide (CBA) by Michael-addition polymerization. In order to characterize these two Gua-SS-PAA polymers and investigate their potentials as short
Yanlin Li et al.
PloS one, 7(8), e44254-e44254 (2012-09-07)
Fanconi anemia complementation group-F (FANCF) is a key factor to maintain the function of FA/BRCA, a DNA-damage response pathway. However, the functional role of FANCF in breast cancer has not been elucidated. In this study, we examined the effects and
Miao He et al.
Oncology reports, 29(5), 1721-1729 (2013-02-27)
In the present study, we downregulated FANCF expression by small interfering RNA (siRNA) in OVCAR ovarian cancer cells to address the effects of decreased FANCF expression on the function of the Fanconi anemia (FA)/breast cancer susceptibility gene (BRCA) pathway. Furthermore
Lin Zhao et al.
International journal of oncology, 45(1), 129-138 (2014-05-03)
The Fanconi anemia/BRCA (FA/BRCA) DNA damage repair pathway plays a pivotal role in the cellular response to DNA alkylating agents and greatly influences drug response in cancer treatment. However, the molecular mechanisms underlying the FA/BRCA pathway reversed resistance have received

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico