Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU003851

Sigma-Aldrich

MISSION® esiRNA

targeting human SAMHD1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGA

Ensembl | nº de acceso humano

ENSG00000101347

Nº de acceso NCBI

NM_015474

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... SAMHD1(25939) , SAMHD1(25939)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QUS
PET
WQS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Weihui Fu et al.
Scientific reports, 6, 38162-38162 (2016-12-07)
SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, while Vpx can mediate SAMHD1 degradation to promote HIV-1 replication. Although the restriction mechanisms of SAMHD1 have been well-described, SAMHD1 expression and Vpx-mediated SAMHD1
Thomas Oellerich et al.
Nature communications, 10(1), 3475-3475 (2019-08-04)
Hypomethylating agents decitabine and azacytidine are regarded as interchangeable in the treatment of acute myeloid leukemia (AML). However, their mechanisms of action remain incompletely understood, and predictive biomarkers for HMA efficacy are lacking. Here, we show that the bioactive metabolite
Jiaming Su et al.
Nature microbiology, 4(12), 2552-2564 (2019-10-30)
Innate immunity is the first line of host defence against pathogens. Suppression of innate immune responses is essential for the survival of all viruses. However, the interplay between innate immunity and HIV/SIV is only poorly characterized. We have discovered Vpx
Vera Rocha-Perugini et al.
Nature microbiology, 2(11), 1513-1522 (2017-09-06)
In this study, we report that the tetraspanin CD81 enhances human immunodeficiency virus (HIV)-1 reverse transcription in HIV-1-infected cells. This is enabled by the direct interaction of CD81 with the deoxynucleoside triphosphate phosphohydrolase SAMHD1. This interaction prevents endosomal accumulation and
Diana Ayinde et al.
Journal of virology, 89(14), 6994-7006 (2015-05-01)
Monocyte-derived dendritic cells (MDDC) stimulate CD8 cytotoxic T lymphocytes (CTL) by presenting endogenous and exogenous viral peptides via major histocompatibility complex class I (MHC-I) molecules. MDDC are poorly susceptible to HIV-1, in part due to the presence of SAMHD1, a

Global Trade Item Number

Número de referencia del producto (SKU)GTIN
EHU003851-20UG4061831360479
EHU003851-50UG4061828452255

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico