Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU002721

Sigma-Aldrich

MISSION® esiRNA

targeting human ERN1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACAGTGACGCTTCCTGAAACCTTGTTGTTTGTGTCAACGCTGGATGGAAGTTTGCATGCTGTCAGCAAGAGGACAGGCTCAATCAAATGGACTTTAAAAGAAGATCCAGTCCTGCAGGTCCCAACACATGTGGAAGAGCCTGCCTTTCTCCCAGATCCTAATGATGGCAGCCTGTATACGCTTGGAAGCAAGAATAATGAAGGCCTGACGAAACTTCCTTTTACCATCCCAGAATTGGTGCAGGCATCCCCATGCCGAAGTTCAGATGGAATCCTCTACATGGGTAAAAAGCAGGACATCTGGTATGTTATTGACCTCCTGACCGGAGAGAAGCAGCAGACTTTGTCATCGGCCTTTGCAGATAGTCTCTGCCCATCAACCTCTCTTCTGTATCTTGGGCGAACAGAATACACCATCACCATGTACGACACCAAAACCCGAGAGCTCCGGTGGAATGCCACCTACTTTGACTATGCGGCCTCACTGCCTGAGGACGACGTGGACTACAAGATGTCCCACTTTGTGTCCAATGGTGATGGGCTGGTGGTGACTGTGGACAGT

Ensembl | nº de acceso humano

ENSG00000178607

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ERN1(2081) , ERN1(2081)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qun Lai et al.
Yonsei medical journal, 54(6), 1407-1415 (2013-10-22)
To investigate the anti-apoptotic mechanism of leptin in non-small cell lung cancer. The influences of leptin on apoptosis were investigated, analyzing the mechanism that triggers growth of A549 cells. The effects of leptin on cell proliferation were examined by XTT
Antonello Storniolo et al.
Oxidative medicine and cellular longevity, 2015, 645157-645157 (2015-04-30)
Relative to their normal counterparts, tumor cells generally exhibit a greater "stress phenotype" and express heat shock proteins (Hsp) that represent candidate targets for anticancer therapy. Here we investigated the role of Hsp70 in survival induced by endoplasmic reticulum (ER)
Xun Yuan et al.
Oncotarget, 8(13), 21626-21638 (2017-04-21)
ONC201 was previously identified as a first-in-class antitumor agent and small-molecule inducer of the TRAIL (tumor necrosis factor-related apoptosis-inducing ligand) gene that induces apoptosis in cancer cells. ONC201 has a safety profile and is currently in phase II clinical trials
Amanda Crider et al.
Molecular neurobiology, 55(9), 7606-7618 (2018-02-13)
Impaired social interaction is a key feature of several major psychiatric disorders including depression, autism, and schizophrenia. While, anatomically, the prefrontal cortex (PFC) is known as a key regulator of social behavior, little is known about the cellular mechanisms that
K W Kim et al.
Oncogene, 29(22), 3241-3251 (2010-03-30)
As apoptosis defects limit efficacy of anticancer agents, autophagy has been proposed as a novel strategy for radiotherapy enhancement. We previously showed that caspase-3/7 inhibition induces autophagy and promotes radiosensitivity in vitro and in vivo. Therefore, we further investigated the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico