Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

View All Documentation

EHU001891

Sigma-Aldrich

MISSION® esiRNA

targeting human INCENP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CACCTGCTGGAGCTATGTGACCAGAAGCTCATGGAGTTTCTCTGCAACATGGATAATAAGGACTTGGTGTGGCTTGAGGAAATCCAAGAGGAGGCCGAGCGCATGTTCACCAGAGAATTCAGCAAAGAGCCAGAGCTGATGCCCAAAACACCTTCTCAGAAGAACCGACGGAAGAAGAGACGGATTTCTTATGTTCAGGATGAAAACAGAGATCCCATCAGGAGAAGGTTATCCCGCAGAAAGTCTCGGAGCAGCCAGCTGAGCTCCCGACGCCTCCGCAGCAAGGACAGTGTAGAGAAGCTGGCTACAGTGGTCGGGGAGAACGGCTCCGTCCTGCGGCGTGTGACCCGTGCTGCGGCTGCAGCTGCCGCGGCTACCATGGCATTGGCTGCACCTTCTTCACCCACCCCTGAGTCTCCCACGATGCTGACTAAGAAGCCCG

Ensembl | nº de acceso humano

ENSG00000149503

Nº de acceso NCBI

NM_020238

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... INCENP(3619) , INCENP(3619)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Andrius Serva et al.
PloS one, 7(12), e52555-e52555 (2013-01-04)
miRNA cluster miR-17-92 is known as oncomir-1 due to its potent oncogenic function. miR-17-92 is a polycistronic cluster that encodes 6 miRNAs, and can both facilitate and inhibit cell proliferation. Known targets of miRNAs encoded by this cluster are largely
Keith F DeLuca et al.
The Journal of cell biology, 217(1), 163-177 (2017-12-01)
Precise regulation of kinetochore-microtubule attachments is essential for successful chromosome segregation. Central to this regulation is Aurora B kinase, which phosphorylates kinetochore substrates to promote microtubule turnover. A critical target of Aurora B is the N-terminal "tail" domain of Hec1
Ming Sun et al.
Cancer research, 79(19), 4937-4950 (2019-08-17)
Chromosomal passenger complex (CPC) has been demonstrated to be a potential target of cancer therapy by inhibiting Aurora B or survivin in different types of cancer including neuroblastoma. However, chemical inhibition of either Aurora B or survivin does not target

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico