Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

Otros documentos

EHU000321

Sigma-Aldrich

MISSION® esiRNA

targeting human THBD

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGTGGATGACTGCATACTGGAGCCCAGTCCGTGTCCGCAGCGCTGTGTCAACACACAGGGTGGCTTCGAGTGCCACTGCTACCCTAACTACGACCTGGTGGACGGCGAGTGTGTGGAGCCCGTGGACCCGTGCTTCAGAGCCAACTGCGAGTACCAGTGCCAGCCCCTGAACCAAACTAGCTACCTCTGCGTCTGCGCCGAGGGCTTCGCGCCCATTCCCCACGAGCCGCACAGGTGCCAGATGTTTTGCAACCAGACTGCCTGTCCAGCCGACTGCGACCCCAACACCCAGGCTAGCTGTGAGTGCCCTGAAGGCTACATCCTGGACGACGGTTTCATCTGCACGGACATCGACGAGTGCGAAAACGGCGGCTTCTGCTCCGGGGTGTGCCACAACCTCCCCGGTACCTTCGAGTGCATCTGCGGGCCCGACTCGGCCCTTGCCCGCCACATTGGCACCGACTGTGACTCCGGCAAGGTGGACGGTGGCGACAGCGGCTCTGGCGAGCCCCCGCCCAGCCCGACGCCCGGCTCCACCTTGACTCCTCCGGCCGTGGGGCTCGTGCATTCGGGCTTGCTCATAGGCATCTCC

Ensembl | nº de acceso humano

ENSG00000178726

Nº de acceso NCBI

NM_000361

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... THBD(7056) , THBD(7056)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
E Klineberg et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 23(11), 2385-2392 (2014-04-18)
Noggin protein levels and spinal fusion rates were compared in a rabbit model after application of siRNA against BMP antagonist noggin in paraspinal muscle. To test whether endogenous BMPs are sufficient to form bone in the absence of their antagonists
Yi Liu et al.
Journal of proteomics, 106, 99-112 (2014-04-29)
Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico