Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

AV38984

Sigma-Aldrich

Anti-MAFF antibody produced in rabbit

IgG fraction of antiserum

Sinónimos:

Anti-v-maf musculoaponeurotic fibrosarcoma oncogene homolog F (avian)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
12352203
NACRES:
NA.41
clon:
polyclonal
application:
WB
reactividad de especies:
mouse, human, dog, bovine, horse, rat, guinea pig, rabbit
técnicas:
western blot: suitable
citations:
3

origen biológico

rabbit

Nivel de calidad

conjugado

unconjugated

forma del anticuerpo

IgG fraction of antiserum

tipo de anticuerpo

primary antibodies

clon

polyclonal

Formulario

buffered aqueous solution

mol peso

18 kDa

reactividad de especies

mouse, human, dog, bovine, horse, rat, guinea pig, rabbit

concentración

0.5 mg - 1 mg/mL

técnicas

western blot: suitable

Nº de acceso NCBI

Nº de acceso UniProt

Condiciones de envío

wet ice

temp. de almacenamiento

−20°C

Información sobre el gen

human ... MAFF(23764)

Inmunógeno

Synthetic peptide directed towards the N terminal region of human MAFF

Acciones bioquímicas o fisiológicas

MAFF is a basic leucine zipper transcription factor that binds to the promoter of oxytocin receptor gene. It lacks a transactivation domain but forms a homodimer that can repress transcription. MAFF reportedly regulates the gene expression in response to proinflammatory cytokines in myometrial cells.

Secuencia

Synthetic peptide located within the following region: SVRELNRHLRGLSAEEVTRLKQRRRTLKNRGYAASCRVKRVCQKEELQKQ

Forma física

Purified antibody supplied in 1x PBS buffer with 0.09% (w/v) sodium azide and 2% sucrose.

Cláusula de descargo de responsabilidad

Unless otherwise stated in our catalog or other company documentation accompanying the product(s), our products are intended for research use only and are not to be used for any other purpose, which includes but is not limited to, unauthorized commercial uses, in vitro diagnostic uses, ex vivo or in vivo therapeutic uses or any type of consumption or application to humans or animals.

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

T Kimura et al.
Biochemical and biophysical research communications, 264(1), 86-92 (1999-10-21)
The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins from human myometrium at parturition. To elucidate the molecular mechanisms involved in OTR gene upregulation at term
Wael Massrieh et al.
Biology of reproduction, 74(4), 699-705 (2005-12-24)
The MAF (proto-)oncogene family of basic-leucine zipper transcription factors plays crucial roles in the control of mammalian gene expression and development. Here we analyzed the regulation of the human MAFF gene, coding for a small MAF transcription factor, in uterine
Daniel N Itzhak et al.
Disease models & mechanisms, 12(11) (2019-10-20)
The unfolded protein response (UPR) involves extensive proteome remodeling in many cellular compartments. To date, a comprehensive analysis of the UPR has not been possible because of technological limitations. Here, we employ stable isotope labeling with amino acids in cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico