Skip to Content
Merck
All Photos(1)

Key Documents

EHU157921

Sigma-Aldrich

MISSION® esiRNA

targeting human TFE3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGAGGCTGCCCACACTACCGGCCCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGAGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAATTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGACCCGGAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Nunzia Pastore et al.
The EMBO journal, 38(12) (2019-05-28)
Autophagy and energy metabolism are known to follow a circadian pattern. However, it is unclear whether autophagy and the circadian clock are coordinated by common control mechanisms. Here, we show that the oscillation of autophagy genes is dependent on the
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and
Na Zhang et al.
EBioMedicine, 40, 151-162 (2019-02-04)
Programmed death-ligand 1 (PD-L1) is a T-cell inhibitory checkpoint molecule that suppresses antitumor immunity. Anti-PD-L1 antibodies have shown remarkable promise in treating tumors, but the patient response rate is low. Therefore, small-molecule checkpoint inhibitors blocking PD-L1 function are urgently needed.

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service