Skip to Content
Merck
All Photos(1)

Key Documents

EHU123971

Sigma-Aldrich

MISSION® esiRNA

targeting human MOK

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCACCCCTACTTCCAAGAACAGAGGAAAACAGAGAAGCGGGCTCTGGGCAGCCACAGAAAAGCTGGCTTTCCGGAGCACCCTGTGGCACCGGAACCACTCAGTAACAGCTGCCAGATTTCCAAGGAGGGCAGAAAGCAGAAACAGTCCCTAAAGCAAGAGGAGGACCGTCCCAAGAGACGAGGACCGGCCTATGTCATGGAACTGCCCAAACTAAAGCTTTCGGGAGTGGTCAGACTGTCGTCTTACTCCAGCCCCACGCTGCAGTCCGTGCTTGGATCTGGAACAAATGGAAGAGTGCCGGTGCTGAGACCCTTGAAGTGCATCCCTGCGAGCAAGAAGACAGATCCGCAGAAGGACCTTAAGCCTGCCCCGCAGCAGTGTCGCCTGCCCACCATAGTGCGGAAAGGCGGAAGATAACTGAGCAGCACCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Wenbin Ye et al.
Apoptosis : an international journal on programmed cell death, 22(1), 86-97 (2016-11-20)
This study aimed to investigate the effect of AOPPs on apoptosis in human chondrocytes. Chondrocytes were treated with AOPPs. Cell death, nicotinamide adenine dinucleotide phosphate (NADPH) oxidase activity, reactive oxygen species (ROS) generation, and the expression of apoptotic proteins were
Bikesh K Nirala et al.
Diabetes & vascular disease research, 12(4), 290-297 (2015-05-13)
Pro-inflammatory conditions induced by products of protein glycation in diabetes substantially enhance the risk of endothelial dysfunction and related vascular complications. Endothelial cell specific molecule-1 (ESM-1) or endocan has been demonstrated as a potential biomarker in cancer and sepsis. Its
Yosuke Kanno et al.
Arthritis research & therapy, 22(1), 76-76 (2020-04-11)
Fibrotic diseases are characterized by tissue overgrowth, hardening, and/or scarring because of the excessive production, deposition, and contraction of the extracellular matrix (ECM). However, the detailed mechanisms underlying these disorders remain unclear. It was recently reported that α2-antiplasmin (α2AP) is
Yan Xia Yu et al.
American journal of translational research, 9(6), 2760-2774 (2017-07-04)
Non-small cell lung cancer (NSCLC) constitutes the main cases of lung cancer and is the world's most common and lethal cancer owing to regional invasion or distant metastasis. Growing morbidity and lethality demonstrates that valid molecular target in management of
Jing Zhou et al.
BioMed research international, 2018, 1650456-1650456 (2018-11-08)
Intermittent hypoxia (IH) that resulted from obstructive sleep apnea (OSA) has been found to be a risk factor of coronary artery disease. IH and the receptor for advanced glycation end products (RAGE) expression are known to activate monocyte/macrophage and associated

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service