Skip to Content
Merck
All Photos(1)

Key Documents

EHU084491

Sigma-Aldrich

MISSION® esiRNA

targeting human CHAF1A

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCTGAATCTTGTCCCAAAGGGGAAAGCCGATGACATGTCAGACGATCAGGGTACTTCTGTGCAAAGTAAAAGCCCCGATTTAGAGGCCTCTTTGGACACCTTGGAAAACAACTGTCATGTGGGTTCTGACATAGACTTTAGACCGAAACTTGTCAACGGGAAGGGTCCCTTAGATAACTTTTTAAGAAATAGAATCGAAACCAGTATTGGCCAGAGCACAGTCATCATTGATTTGACAGAGGACTCGAATGAGCAGCCAGACAGTCTTGTGGACCACAATAAACTAAATTCTGAAGCCTCTCCCTCCAGGGAGGCAATAAATGGCCAGCGAGAAGACACTGGGGATCAGCAGGGGTTGTTGAAGGCCATTCAGAACGACAAGTTGGCATTTCCTGGAGAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem/physiol Actions

CHAF1A (chromatin assembly factor 1 subunit A) is one of the subunits of CAF1 complex, a histone chaperone responsible for the positioning of histone H3 and H4 dimers into nucleosomes. CAF1 is needed for S-phase progression, heterochromatin formation and chromatin restoration after DNA repair. CAF1A is required for promoting protein and chromosome associations with nucleoli. It is required for cell proliferation and is upregulated in colon cancer and aggressive neuroblastoma.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A separable domain of the p150 subunit of human chromatin assembly factor-1 promotes protein and chromosome associations with nucleoli.
Smith CL, et. al.
Molecular Biology of the Cell, 25, 2866-2866 (2014)
The Chromatin Assembly Factor Complex 1 (CAF1) and 5-Azacytidine (5-AzaC) Affect Cell Motility in Src-transformed Human Epithelial Cells.
Endo A
The Journal of Biological Chemistry, 292, 172-172 (2017)
Regulation of oxidized base damage repair by chromatin assembly factor 1 subunit A.
Yang C
Nucleic Acids Research, 45, 739-739 (2017)
Corey L Smith et al.
Molecular biology of the cell, 25(18), 2866-2881 (2014-07-25)
Chromatin assembly factor-1 (CAF-1) is a three-subunit protein complex conserved throughout eukaryotes that deposits histones during DNA synthesis. Here we present a novel role for the human p150 subunit in regulating nucleolar macromolecular interactions. Acute depletion of p150 causes redistribution

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service