Skip to Content
Merck
All Photos(1)

Key Documents

EHU065681

Sigma-Aldrich

MISSION® esiRNA

targeting human ATP8A2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCATGGAGCCTGGAGCTACAACCGGGTGACCAAGTGCATCTTGTACTGCTTCTATAAGAACGTGGTCCTGTATATTATTGAGCTTTGGTTCGCCTTTGTTAATGGATTTTCTGGGCAGATTTTATTTGAACGTTGGTGCATCGGCCTGTACAATGTGATTTTCACCGCTTTGCCGCCCTTCACTCTGGGAATCTTTGAGAGGTCTTGCACTCAGGAGAGCATGCTCAGGTTTCCCCAGCTCTACAAAATCACCCAGAATGGCGAAGGCTTCAACACAAAGGTTTTCTGGGGTCACTGCATCAACGCCTTGGTCCACTCCCTCATCCTCTTCTGGTTTCCCATGAAAGCTCTGGAGCATGATACTGTGTTGACAAGTGGTCATGCTACCGACTATTTATTTGTTGGAAATATTGTTTACACATATGTTGTTGTTACTGTTTGTCTGAAAGCTGGTTTGGAGACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A Dorronsoro et al.
Cell death & disease, 4, e972-e972 (2013-12-21)
The zinc-finger protein A20 is a key player in the negative feedback regulation of the nuclear factor kappa-light-chain-enhancer of activated B-cell (NF-κB) pathway in response to multiple stimuli. Tumor necrosis factor alpha (TNFα), a cytokine with pleiotropic effects on cellular
Kerstin Boengler et al.
Basic research in cardiology, 105(6), 771-785 (2010-10-21)
The signal transducer and activator of transcription 3 (STAT3) contributes to cardioprotection by ischemic pre- and postconditioning. Mitochondria are central elements of cardioprotective signaling, most likely by delaying mitochondrial permeability transition pore (MPTP) opening, and STAT3 has recently been identified
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service