Skip to Content
Merck
All Photos(1)

Key Documents

EHU037901

Sigma-Aldrich

MISSION® esiRNA

targeting human USP1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGACCCTGAGATGGGCAATTTCACAATTTGCTTCAGTAGAAAGGATTGTAGGAGAAGATAAATATTTCTGTGAAAACTGCCATCATTATACTGAAGCTGAACGAAGTCTTTTGTTTGACAAAATGCCTGAAGTTATAACTATTCATTTGAAGTGCTTTGCTGCTAGTGGTTTGGAGTTTGATTGTTATGGTGGTGGACTTTCCAAGATCAACACTCCTTTATTGACACCTCTTAAATTGTCACTAGAAGAATGGAGCACAAAGCCAACTAACGACAGCTATGGATTATTTGCGGTTGTGATGCATAGTGGCATTACAATTAGTAGTGGGCATTACACTGCTTCTGTTAAAGTCACTGACCTTAACAGTTTAGAACTAGATAAAGGAAATTTTGTGGTTGACCAAATGTGTGAAATAGGTAAGCCAGAACCATTGAATGAGGAGGAAGCAAGGGGTGTGGTTGAGAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

M Raimondi et al.
Cell cycle (Georgetown, Tex.), 15(1), 106-116 (2016-01-16)
CAPNS1 is essential for the stability and function of ubiquitous CAPN1 and CAPN2. Calpain modulates by proteolytic cleavage many cellular substrates and its activity is often deregulated in cancer cells, therefore calpain inhibition has been proposed as a therapeutical strategy
Maura Sonego et al.
Science advances, 5(5), eaav3235-eaav3235 (2019-05-16)
Resistance to platinum-based chemotherapy is a common event in patients with cancer, generally associated with tumor dissemination and metastasis. Whether platinum treatment per se activates molecular pathways linked to tumor spreading is not known. Here, we report that the ubiquitin-specific
Dana Goldbraikh et al.
EMBO reports, 21(4), e48791-e48791 (2020-03-07)
PI3K-Akt-FoxO-mTOR signaling is the central pathway controlling growth and metabolism in all cells. Ubiquitination of the protein kinase Akt prior to its phosphorylation is required for PI3K-Akt activity. Here, we found that the deubiquitinating (DUB) enzyme USP1 removes K63-linked polyubiquitin

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service