Skip to Content
Merck
All Photos(1)

Key Documents

EHU014951

Sigma-Aldrich

MISSION® esiRNA

targeting human LRRD1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCAATCAGAGAGATTCCAAGAAATATAGGAGAATTGAGAAATTTGGTTAGTTTACATGCATACAATAATCAAATAAGTTATCTTCCACCATCTTTGCTATCTTTAAATGATCTGCAGCAACTAAACCTGAGTGGAAATAATCTGACAGCTCTACCTAGTGCTATCTACAATATTTTTTCACTGAAGGAGATAAATTTTGATGACAACCCTTTGCTGAGACCTCCAGTGGAAATCTGTAAAGGAAAACAGTTGTATACTATTGCACGCTATCTACAGAGGGCAGATGAAAGAGATGAGAAAATTTTAGAGAAGATATTCAAGATAGTTGCCAACAACATCACTGAAACCAATTTTGAATTTTTATGTCAAAAACTAAACCTGGCAAACTCAGAAACTGATATGCCTACAAAGAGCACTGTTTCATTAAGTGAGAGAGCCCACCAAGCACTTGTTATATGGAAAACACAAAGTAACAAGTTATCACTAACTGCTGCTGCTTTAAGAGATCA

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Alexander J A Deutsch et al.
Cancer research, 77(9), 2375-2386 (2017-03-03)
Nuclear orphan receptor NR4A1 exerts an essential tumor suppressor function in aggressive lymphomas. In this study, we investigated the hypothesized contribution of the related NR4A family member NR4A3 to lymphomagenesis. In aggressive lymphoma patients, low expression of NR4A3 was associated
Masanori Nagaoka et al.
Journal of immunology (Baltimore, Md. : 1950), 199(8), 2958-2967 (2017-09-13)
NR4A3/NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, which is activated in a ligand-independent manner. To examine the role of NR4A3 in gene expression of dendritic cells (DCs), we introduced NR4A3 small interfering RNA (siRNA) into
Xiao-Jun Feng et al.
British journal of pharmacology, 172(11), 2852-2863 (2015-01-28)
The orphan nuclear receptor NOR1 belongs to the NR4A subfamily of the nuclear hormone receptor superfamily, and is involved in glucose and fat metabolism. However, its potential contribution to cardiovascular diseases remains to be assessed. Here, the roles of NOR1

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service