Skip to Content
Merck
All Photos(1)

Key Documents

EMU084431

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gnb2l1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGACAAGCTGGTCAAGGTGTGGAATCTGGCTAACTGCAAGCTAAAGACCAACCACATTGGCCACACTGGCTACCTGAACACAGTGACTGTCTCTCCAGATGGATCCCTCTGTGCTTCTGGAGGCAAGGATGGCCAGGCTATGCTGTGGGATCTCAATGAAGGCAAGCACCTCTACACTTTAGATGGTGGGGACATCATCAATGCCTTGTGCTTCAGCCCCAACCGCTACTGGCTCTGCGCTGCCACTGGCCCCAGCATCAAGATCTGGGACTTGGAGGGCAAGATCATTGTAGATGAATTGAAGCAAGAAGTTATCAGCACCAGCAGCAAGGCAGAGCCACCCCAGTGTACCTCTTTGGCATGGTCTGCTGATGGCCAGACTCTGTTTGCTGGCTATACAGACAACTTGGTGCGAGTATGGCAGGTAACTATTGGTACCCGCTAAAAGTTTTATGACAAAGTCTTAGAAATAAACTGGCTTTCTGAAACTGGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhao-Fei Dong et al.
Molecular neurobiology, 50(2), 438-448 (2014-01-18)
Voltage-gated sodium channel α subunit type I (Nav1.1, encoded by SCN1A gene) plays a critical role in the initiation of action potential in the central nervous system. Downregulated expression of SCN1A is believed to be associated with epilepsy. Here, we
Ti Zhou et al.
Oncology reports, 33(6), 3006-3014 (2015-04-23)
Sorafenib is one of the preferred drugs for the treatment of advanced primary hepatocellular carcinoma (HCC). However, its side-effects and acquired resistance limit its use. The unfolded protein response (UPR) induced by chemotherapeutics has been demonstrated to be required for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service