Skip to Content
Merck
All Photos(1)

Key Documents

EHU084051

Sigma-Aldrich

MISSION® esiRNA

targeting human GRB10

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACAGGACACAGCACTGGTTTCACGGGAGGATCTCCAGGGAGGAATCCCACAGGATCATTAAACAGCAAGGGCTCGTGGATGGGCTTTTTCTCCTCCGTGACAGCCAGAGTAATCCAAAGGCATTTGTACTCACACTGTGTCATCACCAGAAAATTAAAAATTTCCAGATCTTACCTTGCGAGGACGACGGGCAGACGTTCTTCAGCCTAGATGACGGGAACACCAAATTCTCTGACCTGATCCAGCTGGTTGACTTTTACCAGCTGAACAAAGGAGTCCTGCCTTGCAAACTCAAGCACCACTGCATCCGAGTGGCCTTATGACCGCAGATGTCCTCTCGGCTGAAGACTGGAGGAAGTGAACACTGGAGTGAAGAAGCGGTCTGTGCGTTGGTGAAGAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Hui Luo et al.
Frontiers in genetics, 11, 581593-581593 (2020-12-18)
Sertoli cells are central and essential coordinators of spermatogenesis. Accumulating evidence has demonstrated that miRNAs participate in the regulation of Sertoli cell growth. However, the functions and the regulatory mechanisms of miRNAs in Sertoli cells of domestic animals remain largely
Mohammad Imran Khan et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(3), 3198-3211 (2018-11-01)
Growth factor receptor-binding protein 10 (GRB10) is a well-known adaptor protein and a recently identified substrate of the mammalian target of rapamycin (mTOR). Depletion of GRB10 increases insulin sensitivity and overexpression suppresses PI3K/Akt signaling. Because the major reason for the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service