Skip to Content
Merck
All Photos(1)

Key Documents

EMU170821

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Birc5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAAGGAGACCAACAACAAGCAAAAAGAGTTTGAAGAGACTGCAAAGACTACCCGTCAGTCAATTGAGCAGCTGGCTGCCTAATGCTGAGCCTTTGCTGAGATAACTTGGACCTGAGTGACATGCCACATCTAAGCCACGCATCCCAGCTTTTCCAGCCAGGGCCTCCTAGCAGGATCTTAGAGAAGGAGACAGTGGTATTTTGAAACTGGATATCAAATATTTTTGGTTTTGCTTTAAAGTGGCTACCTCTCTTTGGTTTTGTGGCTTTGCTCTATTGTGACGTGGACTTAAGCAATAAGGAAGTGATGAAGGGACAGTGTTCTCTGACAGGACCTGTGGGGGTCGGGGTGCCTGTGCAAGGTCTTGGTTCTGATTGTGATATTTCCATACAGGGCTGCTAATGCAGCCCATGGGTAAGTGTGGTTATATGTGTTTGTGCTGATAATTTTGTCCTGATGAGTTTTCCTACCACGGGGTAACGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Eloïse Véquaud et al.
Breast cancer research and treatment, 155(1), 53-63 (2015-12-19)
Survivin overexpression, frequently found in breast cancers and others, is associated with poor prognosis. Its dual regulation of cell division and apoptosis makes it an attractive therapeutic target but its exact functions that are required for tumor maintenance are still
Sanam Arami et al.
Current pharmaceutical design, 23(16), 2400-2409 (2016-11-02)
Targeted delivery of small interfering RNA (siRNA) to the specific tumor tissues and cells is the key challenge in the development of RNA interference as a therapeutic application. To target breast cancer, we developed a cationic nanoparticle as a therapeutic
Yongping Cai et al.
International journal of clinical and experimental pathology, 8(10), 13267-13272 (2016-01-02)
Survivin, a member of the inhibitor of apoptosis gene family regulates two critical processes in neoplastic transformation, namely, cell proliferation and apoptosis. This study aimed to detect the effect of survivin on tumor growth of colorectal cancer (CRC) in vivo.
Elisabetta Palazzo et al.
International journal of molecular sciences, 16(11), 26291-26302 (2015-11-06)
The Notch signaling pathway orchestrates cell fate by either inducing cell differentiation or maintaining cells in an undifferentiated state. This study aims to evaluate Notch expression and function in normal human keratinocytes. Notch1 is expressed in all epidermal layers, though
Yuhuan Li et al.
Pakistan journal of pharmaceutical sciences, 28(5 Suppl), 1887-1890 (2015-11-04)
Breast cancer resistance to therapy can result from expression of antiapoptotic genes. Survivin is an antiapoptotic gene that is over expressed in most human tumors. RNA interference using short interfering RNA (siRNA) can be used to specifically inhibit survivin expression.

Global Trade Item Number

SKUGTIN
EMU170821-20UG4061828753321
EMU170821-50UG4061831391381

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service