Skip to Content
Merck
All Photos(1)

Key Documents

EHU071901

Sigma-Aldrich

MISSION® esiRNA

targeting human WSB1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTATTGAGGGGGCATCAGAATTGGGTGTACAGCTGTGCATTCTCTCCTGACTCTTCTATGCTGTGTTCAGTCGGAGCCAGTAAAGCAGTTTTCCTTTGGAATATGGATAAATACACCATGATACGGAAACTAGAAGGACATCACCATGATGTGGTAGCTTGTGACTTTTCTCCTGATGGAGCATTACTGGCTACTGCATCTTATGATACTCGAGTATATATCTGGGATCCACATAATGGAGACATTCTGATGGAATTTGGGCACCTGTTTCCCCCACCTACTCCAATATTTGCTGGAGGAGCAAATGACCGGTGGGTACGATCTGTATCTTTTAGCCATGATGGACTGCATGTTGCAAGCCTTGCTGATGATAAAATGGTGAGGTTCTGGAGAATTGATGAGGATTATCCAGTGCAAGTTGCACCTTTGAGCAATGGTCTTTGCTGTGCCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Flore-Anne Poujade et al.
British journal of cancer, 118(9), 1229-1237 (2018-03-16)
Metastatic spread is responsible for the majority of cancer-associated deaths. The tumour microenvironment, including hypoxia, is a major driver of metastasis. The aim of this study was to investigate the role of the E3 ligase WSB-1 in breast cancer biology
Jung Jin Kim et al.
Cell research, 27(2), 274-293 (2016-12-14)
Oncogene-induced senescence (OIS) or apoptosis through the DNA-damage response is an important barrier of tumorigenesis. Overcoming this barrier leads to abnormal cell proliferation, genomic instability, and cellular transformation, and finally allows cancers to develop. However, it remains unclear how the

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service