Skip to Content
Merck
All Photos(1)

Key Documents

EHU062091

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIA

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTCTTTCCAACCCAGACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGATAAAGTCTGGAGGTTGGACCTTGTTATGGTGATTTTGTTTAAAGGTATTCCGCTGGAAAGTACTGATGGCGAGCGCCTTGTAAAGTCCCCACAATGCTCTAATCCAGGGCTCTGTGTCCAACCCCATCACATAGGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCAAGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAATGGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTCACTGAGCTAGTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCAAATTTTTCTCTCTCAGATTTGGAAAGTTCTTCATACTACAGCATGAGTCCAGGAGCAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chin-Cheng Lee et al.
PloS one, 12(3), e0173890-e0173890 (2017-03-23)
MicroRNAs are small noncoding RNAs that post-transcriptionally control the expression of genes involved in glioblastoma multiforme (GBM) development. Although miR-302b functions as a tumor suppressor, its role in GBM is still unclear. Therefore, this study comprehensively explored the roles of
Hairui Yuan et al.
Journal of cellular physiology, 236(3), 1810-1821 (2020-07-24)
miR-142a-5p plays critical roles in multiple biological processes and diseases, such as inflammation and tumorigenesis. However, it remains to be explored if and how miR-142a-5p contributes to osteoblast differentiation. In this study, our results showed that miR-142a-5p was highly expressed
Wenxiang Hu et al.
Cell stem cell, 24(2), 299-308 (2019-01-15)
Thiazolidinedione drugs (TZDs) target the transcriptional activity of peroxisome proliferator activated receptor γ (PPARγ) to reverse insulin resistance in type 2 diabetes, but side effects limit their clinical use. Here, using human adipose stem cell-derived adipocytes, we demonstrate that SNPs
Motoshi Nagao et al.
Nature communications, 7, 11102-11102 (2016-03-24)
Multipotent neural precursor cells (NPCs) generate astrocytes at late stages of mammalian neocortical development. Many signalling pathways that regulate astrocytogenesis directly induce the expression of GFAP, a marker of terminally differentiated astrocytes. However, astrocyte specification occurs before GFAP expression and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service