Skip to Content
Merck
All Photos(1)

Key Documents

EHU054851

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC6

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATGGAAATTCTGGACACCCGCTGGTCCTCAGCTACATCGACCTGTCAGCCTGGTGTTACTACTGTCAGGCCTATGTCCACCACCAGGCTCTCCTAGATGTGAAGAACATCGCCCACCAGAACAAGTTTGGGGAGGATATGCCCCACCCACACTAAGCCCCAGAATACGGTCCCTCTTCACCTTCTGAGGCCCACGATAGACCAGCTGTAGCTCATTCCAGCCTGTACCTTGGATGAGGGGTAGCCTCCCACTGCATCCCATCCTGAATATCCTTTGCAACTCCCCAAGAGTGCTTATTTAAGTGTTAATACTTTTAAGAGAACTGCGACGATTAATTGTGGATCTCCCCCTGCCCATTGCCTGCTTGAGGGGCACCACTACTCCAGCCCAGAAGGAAA

Ensembl | human accession no.

ENSG00000094631

NCBI accession no.

NM_006044

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC6(10013) , HDAC6(10013)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mo Cheng et al.
European journal of pharmacology, 840, 1-8 (2018-10-03)
Emerging evidence shows that cytokines such as interleukins (ILs) are involved in the progression and chemoresistance of multiple tumors, including osteosarcoma (OS). Our present study established the doxorubicin (Dox) resistant human OS MG-63 and HOS cells and named them MG-63/Dox
Lei Yang et al.
Journal of molecular and cellular cardiology, 127, 143-153 (2018-12-26)
Extracellular pH strongly affects cellular metabolism and function. An acidic environment induced under pathological conditions leads to cardiomyocyte injury and dysfunction, but the underlying mechanisms are still poorly understood. Autophagy has been reported as a cytoprotective mechanism that maintains cellular
Shigeki Saito et al.
PloS one, 12(10), e0186615-e0186615 (2017-10-19)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive and fatal disease. Histone deacetylase 6 (HDAC6) alters function and fate of various proteins via deacetylation of lysine residues, and is implicated in TGF-β1-induced EMT (epithelial-mesenchymal transition). However, the role of HDAC6
Liuqing Xu et al.
Oncotarget, 8(51), 88730-88750 (2017-11-29)
The role of histone deacetylase 6 (HDAC6) in peritoneal fibrosis remains unknown. In this study, we examined the effect of HDAC6 inhibition on the epithelial-mesenchymal transition (EMT) of peritoneal mesothelial cells and development of peritoneal fibrosis. Treatment with tubastatin A
Hui-Wen Chiu et al.
Cancers, 11(11) (2019-11-07)
Radiation therapy (RT) is one of the main treatments for triple-negative breast cancer (TNBC). However, many patients experience RT failure due to the metastatic potential of RT and the radiation resistance of several cancers. Histone deacetylase inhibitors (HDACis) can serve
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service