Skip to Content
Merck
All Photos(1)

Key Documents

EHU001251

Sigma-Aldrich

MISSION® esiRNA

targeting human BTG1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCACTGGTTCCCAGAAAAGCCATGCAAGGGATCGGGTTACCGTTGTATTCGCATCAACCATAAAATGGATCCTCTGATTGGACAGGCAGCACAGCGGATTGGACTGAGCAGTCAGGAGCTGTTCAGGCTTCTCCCAAGTGAACTCACACTCTGGGTTGACCCCTATGAAGTGTCCTACAGAATTGGAGAGGATGGCTCCATCTGTGTGCTGTATGAAGCCTCACCAGCAGGAGGTAGCACTCAAAACAGCACCAACGTGCAAATGGTAGACAGCCGAATCAGCTGTAAGGAGGAACTTCTCTTGGGCAGAACGAGCCCTTCCAAAAACTACAATATGATGACTGTATCAGGTTAAGATATAGTCTGTGGATGGATCATCTGATGATGATGGATAAATTTGATTTTTGCTTTGGGTGGGCTCCTCTTGGGGATGGATTATGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jeong Sook Kim et al.
International journal of molecular sciences, 20(13) (2019-07-22)
Estrogen affects endometrial cellular proliferation by regulating the expression of the c-myc gene. B-cell translocation gene 1 (BTG1), a translocation partner of the c-myc, is a tumor suppressor gene that promotes apoptosis and negatively regulates cellular proliferation and cell-to-cell adhesion.
Peng Yin et al.
Cancer chemotherapy and pharmacology, 81(5), 863-872 (2018-03-15)
Nasopharyngeal carcinoma (NPC) is one of the most commonly diagnosed cancers worldwide with significantly high prevalence in Southern China. Chemoprevention of cancer with alkylating agent compounds could potentially reverse, suppress, or prevent cancer progression. Cisplatin (CIS) is an antineoplastic or
Zhen-Zhen Zhang et al.
American journal of physiology. Endocrinology and metabolism, 316(6), E1050-E1060 (2019-03-06)
Diabetic retinopathy (DR) is a serious diabetic complication caused by both environmental and genetic factors. Molecular mechanisms of DR may lead to the discovery of reliable prognostic indicators. The current study aimed to clarify the mechanism of microRNA-183 (miR-183) in

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service