Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU082481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stat3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATATGCAGCCAGCAAAGAGTCACATGCCACGTTGGTGTTTCATAATCTCTTGGGTGAAATTGACCAGCAATATAGCCGATTCCTGCAAGAGTCCAATGTCCTCTATCAGCACAACCTTCGAAGAATCAAGCAGTTTCTGCAGAGCAGGTATCTTGAGAAGCCAATGGAAATTGCCCGGATCGTGGCCCGATGCCTGTGGGAAGAGTCTCGCCTCCTCCAGACGGCAGCCACGGCAGCCCAGCAAGGGGGCCAGGCCAACCACCCAACAGCCGCCGTAGTGACAGAGAAGCAGCAGATGTTGGAGCAGCATCTTCAGGATGTCCGGAAGCGAGTGCAGGATCTAGAACAGAAAATGAAGGTGGTGGAGAACCTCCAGGACGACTTTGATTTCAACTACAAAACCCTCAAGAGCCAAGGAGACATGCAGGATCTGAATGGAAACAACCAGTCTGTGACCAGACAGAAGATGCAGCAGCTG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000004040

NCBI-Hinterlegungsnummer

NM_213659

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... STAT3(20848) , Stat3(20848)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qiuping Zhao et al.
International immunopharmacology, 25(2), 242-248 (2015-02-15)
High-glucose-induced low-grade inflammation has been regarded as a key event in the onset and progression of endothelial dysfunction in diabetic vascular complications. Ginkgolide A (GA), a major compound from Ginkgo biloba extract, is widely used for the treatment of cardiovascular
Chunli Shao et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(15), 4154-4166 (2014-06-08)
Lung cancer stem cells (CSC) with elevated aldehyde dehydrogenase (ALDH) activity are self-renewing, clonogenic, and tumorigenic. The purpose of our study is to elucidate the mechanisms by which lung CSCs are regulated. A genome-wide gene expression analysis was performed to
Ling Qin et al.
American journal of translational research, 7(5), 878-890 (2015-07-16)
MiR-29b has been reported to function as a tumor suppressor in a variety of cancers. However, its role in the regulation of breast cancer is controversial. In this paper, we explored the expression of miR-29b in a cohort of 67
S Timme et al.
Oncogene, 33(25), 3256-3266 (2013-08-06)
Signal transducer and activator of transcription 3 (STAT3) is altered in several epithelial cancers and represents a potential therapeutic target. Here, STAT3 expression, activity and cellular functions were examined in two main histotypes of esophageal carcinomas. In situ, immunohistochemistry for
Anuradha Bandaru et al.
European journal of immunology, 44(7), 2013-2024 (2014-03-20)
We studied the factors that regulate IL-23 receptor expression and IL-17 production in human tuberculosis infection. Mycobacterium tuberculosis (M. tb)-stimulated CD4(+) T cells from tuberculosis patients secreted less IL-17 than did CD4(+) T cells from healthy tuberculin reactors (PPD(+) ).
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.