Direkt zum Inhalt
Merck

EMU058651

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Aof2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACTGCCCTCTGCAAGGAATATGATGAATTAGCTGAAACACAAGGAAAGCTAGAAGAAAAACTTCAAGAATTGGAAGCCAATCCCCCAAGTGATGTATACCTCTCATCAAGAGACAGACAAATACTTGACTGGCATTTTGCAAATCTTGAATTTGCCAACGCCACACCTCTCTCTACCCTCTCTCTTAAACATTGGGATCAGGATGATGACTTTGAGTTTACTGGAAGCCACCTGACAGTAAGGAATGGCTACTCATGTGTGCCTGTGGCTTTAGCTGAAGGCTTGGACATTAAACTGAACACAGCAGTGCGGCAGGTTCGCTACACAGCCTCAGGATGTGAAGTGATTGCTGTGAACACACGTTCCACAAGTCAAACCTTTATTTATAAGTGTGATGCAGTTCTCTGTACACTTCCTTTGGGAGTGTTGAAGCAGCAGCCACCAGCTGTTCAGTTTGTGCCACCTCTTCCTGAGTGGAAAACATCTGCAGTCCAAAGGATGGGATTTGGCAACCTTAACAAGGTGGTGTTATGCTTTGACCGTGTGTTCTGGGACCCAAGT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Melissa M Singh et al.
Neuro-oncology, 17(11), 1463-1473 (2015-03-22)
Glioblastoma (GBM) is the most common and aggressive form of brain cancer. Our previous studies demonstrated that combined inhibition of HDAC and KDM1A increases apoptotic cell death in vitro. However, whether this combination also increases death of the glioma stem
Ghanshyam Upadhyay et al.
Proceedings of the National Academy of Sciences of the United States of America, 111(22), 8071-8076 (2014-05-21)
Lysine-specific demethylase 1 (LSD1) demethylates nucleosomal histone H3 lysine 4 (H3K4) residues in collaboration with the corepressor CoREST/REST corepressor 1 (Rcor1) and regulates cell fates by epigenetically repressing gene targets. The balanced regulation of this demethylase, if any, is however
Stefano Amente et al.
Oncotarget, 6(16), 14572-14583 (2015-06-13)
The chromatin-modifying enzyme lysine-specific demethylase 1, KDM1A/LSD1 is involved in maintaining the undifferentiated, malignant phenotype of neuroblastoma cells and its overexpression correlated with aggressive disease, poor differentiation and infaust outcome. Here, we show that LSD1 physically binds MYCN both in
Sathiya Pandi Narayanan et al.
Cancer letters, 367(2), 162-172 (2015-08-01)
The histone demethylase KDM1A specifically demethylates lysine residues and its deregulation has been implicated in the initiation and progression of various cancers. However, KDM1A's molecular role and its pathological consequences, and prognostic significance in oral cancer remain less understood. In

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.