Direkt zum Inhalt
Merck

EMU050451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Suz12

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATGGCTCCTATGCAGGAAATCCTCAGGATATACATCGCCAACCTGGATTTGCTTTTAGTCGAAATGGACCGGTAAAGAGAACACCTATCACACATATTCTTGTTTGCAGGCCAAAAAGAACAAAAGCAAGCATGTCGGAGTTTCTTGAATCTGAAGATGGAGAAGTGGAGCAGCAGAGAACATACAGCAGTGGCCACAATCGTCTCTATTTCCACAGTGATACCTGCTTACCTCTTCGGCCACAAGAAATGGAAGTAGATAGTGAAGATGAGAAAGATCCAGAATGGCTGAGAGAAAAAACCATTACTCAAATTGAAGAATTTTCTGATGTGAATGAAGGAGAGAAAGAAGTGATGAAGCTGTGGAACCTCCATGTCATGAAGCATGGATTTATTGCTGACAATCAAATGAATCATGCCTGTATGCTGTTTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Weisi Liu et al.
The Journal of biological chemistry, 290(47), 28489-28501 (2015-10-08)
Our previous studies identified the oncogenic role of p21-activated kinase 1 (PAK1) in hepatocellular carcinoma (HCC) and renal cell carcinoma (RCC). Contrarily, PAK6 was found to predict a favorable prognosis in RCC patients. Nevertheless, the ambiguous tumor suppressive function of
Ming-de Huang et al.
Journal of hematology & oncology, 8, 50-50 (2015-05-15)
Hepatocellular carcinoma (HCC) is one of the leading causes of cancer-related death, especially in China. And the mechanism of its progression remains poorly understood. Growing evidence indicates that long non-coding RNAs (lncRNAs) are found to be dysregulated in many cancers
Xuefei Shi et al.
Molecular carcinogenesis, 54 Suppl 1, E1-E12 (2013-12-21)
In more recent years, long non-coding RNAs (lncRNAs) have been investigated as a new class of regulators of cellular processes, such as cell growth, apoptosis, and carcinogenesis. Although lncRNAs are dysregulated in numerous cancer types, limited data are available on
Michael Anthony Ruiz et al.
PloS one, 10(4), e0123987-e0123987 (2015-04-18)
Glucose-induced augmented vascular endothelial growth factor (VEGF) production is a key event in diabetic retinopathy. We have previously demonstrated that downregulation of miR-200b increases VEGF, mediating structural and functional changes in the retina in diabetes. However, mechanisms regulating miR-200b in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.