Direkt zum Inhalt
Merck

EMU048091

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt3a

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGGAGAAATGCCACTGTGTTTTCCATTGGTGCTGCTACGTCAGCTGCCAGGAGTGCACACGTGTCTATGACGTGCACACCTGCAAGTAGGAGAGCTCCTAACACGGGAGCAGGGTTCATTCCGAGGGGCAAGGTTCCTACCTGGGGGCGGGGTTCCTACTTGGAGGGGTCTCTTACTTGGGGACTCGGTTCTTACTTGAGGGCGGAGATCCTACCTGTGAGGGTCTCATACCTAAGGACCCGGTTTCTGCCTTCAGCCTGGGCTCCTATTTGGGATCTGGGTTCCTTTTTAGGGGAGAAGCTCCTGTCTGGGATACGGGTTTCTGCCCGAGGGTGGGGCTCCACTTGGGGATGGAATTCCAATTTGGGCCGGAAGTCCTACCTCAATGGCTTGGACTCCTCTCTTGACCCGACAG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hui Xu et al.
Oncology reports, 41(2), 1180-1188 (2018-11-16)
Fine particulate matter (PM2.5) is associated with an increased lung cancer risk. However, the effect of PM2.5 exposure on lung cancer cells is still largely unknown. The present study revealed that A549 lung cancer cells secreted exosomes containing high levels
Yan Xia Yu et al.
American journal of cancer research, 7(11), 2144-2156 (2017-12-09)
Therapeutic antibodies targeting colony stimulating factor 1 receptor (CSF-1R) to block colony stimulating factor-1/colony stimulating factor 1 receptor (CSF-1/CSF-R) signaling axis have exhibit remarkable efficacy in the treatment of malignant tumor. Yet, little is known about the effects of intrinsic
Jaewoong Jang et al.
Scientific reports, 7, 41612-41612 (2017-01-28)
In this study, LPS-induced inflammatory responses in BEAS-2B human bronchial epithelial cells and human umbilical vein endothelial cell (HUVEC)s were found to be prevented by Dickkopf-1 (DKK-1), a secreted Wnt antagonist, and LGK974, a small molecular inhibitor of the Wnt
Weifeng Zou et al.
Respiratory physiology & neurobiology, 221, 1-10 (2015-10-17)
A deficiency of surfactant proteins A and D has been proposed as a mechanism in airway remodeling, which is one characteristic of chronic obstructive pulmonary disease (COPD). We recently showed that in vitro nicotine exposure induces Wnt3a/β-catenin activation, which is
Fei Han et al.
Scientific reports, 9(1), 16861-16861 (2019-11-16)
The Wnt/β-catenin pathway is one of the most conserved signaling pathways across species with essential roles in development, cell proliferation, and disease. Wnt signaling occurs at the protein level and via β-catenin-mediated transcription of target genes. However, little is known

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.