Direkt zum Inhalt
Merck

EMU043861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mmp2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAGAAGGCTGTGTTCTTCGCAGGGAATGAGTACTGGGTCTATTCTGCTAGTACTCTGGAGCGAGGATACCCCAAGCCACTGACCAGCCTGGGGTTGCCCCCTGATGTCCAGCAAGTAGATGCTGCCTTTAACTGGAGTAAGAACAAGAAGACATACATCTTTGCAGGAGACAAGTTCTGGAGATACAATGAAGTGAAGAAGAAAATGGACCCCGGTTTCCCTAAGCTCATCGCAGACTCCTGGAATGCCATCCCTGATAACCTGGATGCCGTCGTGGACCTGCAGGGTGGTGGTCATAGCTACTTCTTCAAGGGTGCTTATTACCTGAAGCTGGAGAACCAAAGTCTCAAGAGCGTGAAGTTTGGAAGCATCAAATCAGACTGGCTGGGCTGCTGAGCTGGCCCTGTTCCCACGGGCCCTATCATCTTCATCGCTGCACACCAGGTGAAGGATGTGAAGCAGCCTGGCGGCTCTGTCCTCCTCTGTAGTTAACCAGCCTTCTCCTTCACCTGGTGACTTCAGATTTAAGAGGGTGGCTTCTTTTTGTGCCCAAAG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yijing Chu et al.
Experimental cell research, 337(1), 16-27 (2015-07-26)
Adipose-derived mesenchymal stem cell (ADSC) is an important component of tumor microenvironment. However, whether ADSCs have a hand in ovarian cancer progression remains unclear. In this study, we investigated the impact of human ADSCs derived from the omentum of normal
Eric A Voll et al.
Oncotarget, 5(9), 2648-2663 (2014-05-07)
Prostate cancer (PCa) is the most common form of cancer in American men. Mortality from PCa is caused by the movement of cancer cells from the primary organ to form metastatic tumors at distant sites. Heat shock protein 27 (HSP27)
Irina Gradinaru et al.
PloS one, 10(11), e0142787-e0142787 (2015-11-17)
α1a Adrenergic receptors (α1aARs) are the predominant AR subtype in human vascular smooth muscle cells (SMCs). α1aARs in resistance vessels are crucial in the control of blood pressure, yet the impact of naturally occurring human α1aAR genetic variants in cardiovascular
Suping Yang et al.
Molecular medicine reports, 12(5), 6990-6996 (2015-09-10)
Prostate cancer (PCa) is the second leading cause of cancer‑related mortality among American males. Studies suggest that cigarette smoking is associated with the progression of PCa; however, the molecular mechanisms underlying this process have not been extensively investigated. PCa progression

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.