Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU023701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nox4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGGAAGAACCCAAGTTCCAAGCTCATTTCCCACAGACCTGGATTTGGATTTCTGGACCTTTGTGCCTTTATTGTGCGGAGAGACTTTACCGATGCATCAGGAGCAACAAACCTGTCACCATCATCTCAGTCATCAATCATCCCTCTGATGTAATGGAACTCCGTATGATCAAAGAAAACTTTAAAGCAAGACCTGGCCAGTATATTATTCTCCATTGCCCCAGTGTATCAGCATTAGAAAACCACCCATTTACTCTCACAATGTGTCCTACTGAAACCAAAGCAACATTTGGTGTCCACTTTAAAGTAGTAGGAGACTGGACAGAACGATTCCGGGATTTGCTACTGCCTCCATCAAGTCAAGACTCTGAGATTCTGCCCTTCATTCACTCTAGAAATTACCCTAAGTTATACATTGATGGTCCATTTGGAAGCCCATTTGAGGAGTCA

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000030562

NCBI-Hinterlegungsnummer

NM_015760

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... NOX4(50490) , Nox4(50490)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Aleksandr E Vendrov et al.
Antioxidants & redox signaling, 23(18), 1389-1409 (2015-06-10)
Increased oxidative stress and vascular inflammation are implicated in increased cardiovascular disease (CVD) incidence with age. We and others demonstrated that NOX1/2 NADPH oxidase inhibition, by genetic deletion of p47phox, in Apoe(-/-) mice decreases vascular reactive oxygen species (ROS) generation
Motoya Tanaka et al.
Oncology reports, 34(4), 1726-1732 (2015-08-05)
Malignant pleural mesothelioma (MPM) is an aggressive tumor that is characterized by dysregulated growth and resistance to apoptosis. Reactive oxygen species (ROS)-generating NADPH oxidase (Nox) family enzymes have been suggested to be involved in neoplastic proliferation. Both the antioxidant N-acetylcysteine
Jin-Ran Chen et al.
The Journal of biological chemistry, 290(23), 14692-14704 (2015-04-30)
Bone remodeling is age-dependently regulated and changes dramatically during the course of development. Progressive accumulation of reactive oxygen species (ROS) has been suspected to be the leading cause of many inflammatory and degenerative diseases, as well as an important factor
Qian Jiang et al.
PloS one, 9(9), e107135-e107135 (2014-09-10)
Our previous studies demonstrated that bone morphogenetic protein 4 (BMP4) mediated, elevated expression of canonical transient receptor potential (TRPC) largely accounts for the enhanced proliferation in pulmonary arterial smooth muscle cells (PASMCs). In the present study, we sought to determine
Cheng-Chang Yeh et al.
Clinical oral investigations, 19(6), 1463-1471 (2014-12-04)
Triethylene glycol dimethacrylate (TEGDMA) is a common component of resin-based dental composites and endodontic sealers. TEGDMA induces apoptosis in several types of cells. However, the mechanisms are not completely understood. The aim of this study was to investigate the mechanisms
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.