Direkt zum Inhalt
Merck

EMU016691

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Fis1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAGACTGTGGCCCAGTAGAGACCTTAGTGTGAGGCTTTCAGGGGCGGCGGCCATGGAGGCCGTGCTGAACGAGCTGGTGTCTGTGGAGGATCTGAAGAATTTTGAAAGGAAATTTCAGTCTGAGCAGGCAGCTGGTTCTGTGTCCAAGAGCACGCAATTTGAATATGCCTGGTGCCTGGTTCGAAGCAAATACAATGAGGACATCCGCAGAGGCATCGTGCTGCTGGAGGAGCTGTTGCCCAAAGGGAGCAAAGAGGAACAGCGGGACTATGTCTTCTACCTGGCCGTGGGCAACTACCGGCTCAAGGAATATGAAAAGGCTCTAAAGTATGTGCGAGGGCTGTTGCAGACTGAGCCCCAGAACAACCAGGCCAAGGAGCTGGAACGCCTGATTGATAAGGCCATGAAGAAAGATGGACTGGTAGGCATGG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jichi Zhou et al.
Cell stress & chaperones, 24(2), 369-383 (2019-01-19)
Sirtuin 3 (Sirt3)-modified mitochondrial fission participates in the progression of several types of cancers. However, its role in tongue cancer requires investigation. The aim of our study is to determine whether Sirt3 knockdown regulates the viability of tongue cancer cells
Qinfang Shen et al.
Molecular biology of the cell, 25(1), 145-159 (2013-11-08)
Mitochondrial fission is mediated by the dynamin-related protein Drp1 in metazoans. Drp1 is recruited from the cytosol to mitochondria by the mitochondrial outer membrane protein Mff. A second mitochondrial outer membrane protein, named Fis1, was previously proposed as recruitment factor
Dongjoon Kim et al.
Cells, 9(7) (2020-07-16)
Diabetic retinopathy is a prevalent microvascular complication characterized by apoptotic vascular cell loss in the retina. Previous studies have shown that high glucose (HG)-induced mitochondrial fragmentation plays a critical role in promoting retinal vascular cell apoptosis. Here, we investigated whether
Mitsuo Kato et al.
Communications biology, 4(1), 30-30 (2021-01-06)
Diabetic kidney disease (DKD) is a major complication of diabetes. Expression of members of the microRNA (miRNA) miR-379 cluster is increased in DKD. miR-379, the most upstream 5'-miRNA in the cluster, functions in endoplasmic reticulum (ER) stress by targeting EDEM3.
Hidenori Otera et al.
The Journal of cell biology, 191(6), 1141-1158 (2010-12-15)
The cytoplasmic dynamin-related guanosine triphosphatase Drp1 is recruited to mitochondria and mediates mitochondrial fission. Although the mitochondrial outer membrane (MOM) protein Fis1 is thought to be a Drp1 receptor, this has not been confirmed. To analyze the mechanism of Drp1

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.