Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EMU013051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cav1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATCAGCACGCAGAAAGAGATATGAGGGACATTTCAAGGATGAAAGGTTTTTTCCCCCCTTACTATTTCCTTGGTGCCAATTCCAAGTTGCTCTCGCAGCAGCAAATTTATGAATGGTTTGTCTTGATCAAGAACAAAGAATTCATTCCCACCATTCTCATATATACTACTTGTCTCTTCTAAGCTACTGCATCTATGTTTGACAGTCTGGAATGTTTAAACCCATTCCTGCTCTCTCTTTTATATGTGAATCATTGTTTCATTGGCTAAAATATAAACATATTGTTGAAAGATGATTTGAGAAAAATAGGAAGGACTGGGAGGCAGGGAAGAGTACCAACAACCTCAACTGCCTACTCAAAGGTGATGATGTCATACAAAGGGAAGAGATTCAGGTTACGGCCATTTGTTTAGGGGCATGAAGG

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000007655

NCBI-Hinterlegungsnummer

NP_031642

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... CAV1(12389) , Cav1(12389)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Emily J Guggenheim et al.
Nanotoxicology, 14(4), 504-532 (2020-02-11)
Engineered Nanomaterials (NMs), such as Superparamagnetic Iron Oxide Nanoparticles (SPIONs), offer significant benefits in a wide range of applications, including cancer diagnostic and therapeutic strategies. However, the use of NMs in biomedicine raises safety concerns due to lack of knowledge
Jing Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(4), 1289-1300 (2015-10-03)
Pulmonary microvascular endothelial cell (PMVEC) proliferation and angiogenesis contribute to the development of hepatopulmonary syndrome (HPS). MicroRNA-199a-5p (miR-199a-5p) has emerged as a potent regulator of angiogenesis, and its expression levels significantly decrease in the serum of patients with hepatopathy. However
Carmen Juks et al.
Biochimica et biophysica acta, 1848(12), 3205-3216 (2015-09-27)
Cell penetrating peptides are efficient tools to deliver various bioactive cargos into cells, but their exact functioning mechanism is still debated. Recently, we showed that a delivery peptide PepFect14 condenses oligonucleotides (ON) into negatively charged nanocomplexes that are taken up
Fanrui Meng et al.
PloS one, 10(5), e0126056-e0126056 (2015-05-06)
Expression of Caveolin-1 (Cav1), a key component of cell surface caveolae, is elevated in prostate cancer (PCa) and associated with PCa metastasis and a poor prognosis for PCa patients. Polymerase I and Transcript Release Factor (PTRF)/cavin-1 is a cytoplasmic protein
Q Chen et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 33-38 (2015-05-31)
Bladder cancer occurs in the majority of cases in males, which represents the fourth highest incident cancer in men and tenth in women. It is associated with a high rate of recurrence, and prognosis is poor once the cancer metastasizes
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.