Direkt zum Inhalt
Merck

EMU010641

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Map2k1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCAGCATCTGAGCCTTTAGGAAGCAGCAAAGAGGAATTCTCTGCCCAGTGGCATGCCATGTTGCTTTCAGGCCTCTCCCATGCTTGTCTATGTTCAGACGTGCATCTCATCTGTGACAAAGGATGAAGAACACAGCATGTGCCAAATTGTACTTGTGTCATTTTTAATATCATTGTCTTTATCACTATGGTTACTCCCCTAAGTGGATTGGCTTTGTGCTTGGGGCTATTTGTCTGTTCATCAAACACATGCCAGGCTGAACTACAGTGAAACCCTAGTGACCTGGGTGGTCGTTCTTACTGATGTTTGCACTGCTGTTCATCGTGACTCACTAGCTGGCTGCCTGTATTGTCAGGATTCTCGGACCTTGGTACTTCACTCTTGCTGGTGACCTCTCAGTCTGAGAGGGAGCCTTGTG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem./physiol. Wirkung

Map2k1 (dual specificity mitogen-activated protein kinase kinase 1) is a serine threonine kinase and is required for ERK (extracellular-signal-regulated kinase) activation. Activation of ERK is associated with production of IL-10 (interleukin 10) and IL-12. Absence of the Map2k1 gene results in embryonic lethality. Map2k1 is responsible for the stimulation of epidermal proliferation, regulating cell migration in fibroblasts. Deficiency of Map2k1 protein causes lupus-like syndrome.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jui-Tai Chen et al.
Toxicology, 339, 40-50 (2015-12-15)
Glutamate can activate NMDA receptor (NMDAR) and subsequently induces excitotoxic neuron loss. However, roles of NMDARs in the blood-brain barrier (BBB) are little known. This study used a mouse cerebrovascular endothelial cell (MCEC) model to evaluate the effects of NMDAR
Mohamad Bouhamdan et al.
Cellular signalling, 27(10), 2068-2076 (2015-07-26)
The mitogen activated protein kinases ERK1/2 play an important role in response to toll like receptor (TLR) activation and cytokine production, including IL-10 and IL-12. Here, we examined the role of MEK1 in ERK1/2 activation in response to TLR4 agonist
Elisa Zienert et al.
Cancer letters, 364(1), 17-24 (2015-04-29)
Numerous factors determine the current poor prognosis of pancreatic ductal adenocarcinoma (PDAC). One of the greatest challenges to overcome is treatment resistance. Among a large repertoire of intrinsic resistance mechanisms, integrin-mediated cell adhesion to extracellular matrix (ECM) has been identified
Li Ren Kong et al.
Molecular cancer therapeutics, 14(7), 1750-1760 (2015-05-06)
Genomic analyses of squamous cell carcinoma (SCC) have yet to yield significant strategies against pathway activation to improve treatment. Platinum-based chemotherapy remains the mainstay of treatment for SCC of different histotypes either as a single-agent or alongside other chemotherapeutic drugs

Global Trade Item Number

SKUGTIN
EMU010641-50UG4061828440412
EMU010641-20UG4061831368543

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.