Direkt zum Inhalt
Merck

EMU003031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Xiap

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCGGGAGCAGCTATCTATCACTTGAGGTCCTGATTGCAGATCTTGTGAGTGCTCAGAAAGATAATACGGAGGATGAGTCAAGTCAAACTTCATTGCAGAAAGACATTAGTACTGAAGAGCAGCTAAGGCGCCTACAAGAGGAGAAGCTTTCCAAAATCTGTATGGATAGAAATATTGCTATCGTTTTTTTTCCTTGTGGACATCTGGCCACTTGTAAACAGTGTGCAGAAGCAGTTGACAAATGTCCCATGTGCTACACCGTCATTACGTTCAACCAAAAAATTTTTATGTCTTAGTGGGGCACCACATGTTATGTTCTTCTTGCTCTAATTGAATGTGTAATGGGAGCGAACTTTAAGTAATCCTGCATTTGCATTCCATTAGCATCCTGCTGTTTCCAAATGG

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... Xiap(11798)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Anak A S S K Dharmapatni et al.
Mediators of inflammation, 2015, 564042-564042 (2015-09-09)
To investigate the effect of Embelin, an inhibitor of X-Linked Inhibitor of Apoptosis Protein (XIAP), on inflammation and bone erosion in a collagen antibody induced arthritis (CAIA) in mice. Four groups of mice (n = 6 per group) were allocated:
N Raulf et al.
British journal of cancer, 111(10), 1955-1964 (2014-10-15)
Current treatment strategies for head and neck cancer are associated with significant morbidity and up to 50% of patients relapse, highlighting the need for more specific and effective therapeutics. Tumour necrosis factor-related apoptosis-inducing ligand (TRAIL) and Smac mimetics (SMs) are
Azhar R Hussain et al.
The Journal of clinical endocrinology and metabolism, 100(7), E974-E985 (2015-05-15)
Papillary thyroid cancer (PTC) is the second most common cancer in females in Saudi Arabia. However, the pathogenesis of PTC is still not fully elucidated. To identify potential genes that play important role in progression of PTC, we studied the
Sojung Park et al.
Anticancer research, 34(7), 3557-3562 (2014-07-02)
Despite the selectivity of Tumor necrosis factor Related Apoptosis-Inducing Ligand (TRAIL) for cancer cell killing activity, breast cancer cells are resistant to TRAIL-induced apoptosis for various reasons. From a functionally-characterized small-molecule dataset, CGP74514A was identified as a TRAIL sensitizer in
Cheng-Yu Tsai et al.
Metallomics : integrated biometal science, 7(11), 1477-1487 (2015-07-25)
Mammalian cells have two influx Cu transporters that form trimers in membranes. CTR1 is the high affinity transporter that resides largely in the plasma membrane, and CTR2 is the low affinity transporter that is primarily associated with vesicular structures inside

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.