Direkt zum Inhalt
Merck

EMU001851

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nkx3-1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTGGCATCCATCTTTCTGGTAGCAACAGTTCTGCTGATAACTGCATATATCAGAAACTGTCTTCCCTGGGGGTCTCTGGGAAAAAGCCACAGTGGCTGATGTCAAGGAGTCGGAAGCAAGAAATGTACAGATGCAAACTGTTGGGGGTTCCCAGGGAACACTCCAATTCTTCTCTGGTGGGCAGGTGAAAGATCTGGGGCAGTGACTATTTGAAGATGTAGTCCCAGTTCCAAGTGTCCTGTAGGTGACTGCTGCCCGCTCCCCTGTTTAGAGAGAGCCAGGCAAGTTTGAGTCTTGTTTCCAGAACTTAGAATGGCTACAGATGCAATGGCTATATCGTTCCTAGGAATTCTGTTGTGGCAACTCCATCCTCTCCCATGACTGAGTATCATGGAAGGGCCAA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xi-Liang Wang et al.
PloS one, 10(8), e0136049-e0136049 (2015-08-28)
MicroRNA (miRNA) is a kind of short non-coding RNA, involved in various cellular processes. During keratinocyte differentiation, miRNAs act as important regulators. In this study, we demonstrated by microarray assay that the expression of miR-378b significantly increased during keratinocytes differentiation.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.