Direkt zum Inhalt
Merck

EHU228771

Sigma-Aldrich

MISSION® esiRNA

targeting human USP17L2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGGATTTCAGACACTTTTGACCCTTACCTGGACATCGCCCTGGATATCCAGGCAGCTCAGAGTGTCAAGCAAGCTTTGGAACAGTTGGTGAAGCCCGAAGAACTCAATGGAGAGAATGCCTATCATTGCGGTCTTTGTCTCCAGAGGGCGCCGGCCTCCAAGACGTTAACTTTACACACTTCTGCCAAGGTCCTCATCCTTGTCTTGAAGAGATTCTCCGATGTCACAGGCAACAAACTTGCCAAGAATGTGCAATATCCTGAGTGCCTTGACATGCAGCCATACATGTCTCAGCAGAACACAGGACCTCTTGTCTATGTCCTCTATGCTGTGCTGGTCCACGCTGGGTGGAGTTGTCACGACGGACATTACTTCTCTTATGTCAAAGCTCAAGAAGGCCAGTGGTATAAAATGGATGATGCCAAGGTCACTGCCTGTAGCATCACTTCTGTCCTGAGTCAACAGGCCTATGTCCTCTTTTACATCCAGAAGAGTGAATGGGAAAGACACAGTGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Gabor Borbely et al.
Oncotarget, 6(32), 33623-33635 (2015-09-18)
Members of the bromodomain and extra-C terminal (BET) domain protein family and the histone deacetylase (HDAC) enzyme family regulate the expression of important oncogenes and tumor suppressor genes. Here we show that the BET inhibitor JQ1 inhibits proliferation and induces
Michelle de la Vega et al.
Nature communications, 2, 259-259 (2011-03-31)
Deubiquitinating enzymes are now emerging as potential therapeutic targets that control many cellular processes, but few have been demonstrated to control cell motility. Here, we show that ubiquitin-specific protease 17 (USP17) is rapidly and transiently induced in response to chemokines
M Mehić et al.
Oncogenesis, 6(6), e348-e348 (2017-06-13)
The levels of hyaluronan, a ubiquitous glycosaminoglycan prominent in the extracellular matrix, is balanced through the actions of hyaluronan-synthesizing enzymes (HAS1, 2 and 3) and degrading hyaluronidases (Hyal 1, 2, 3 and PH20). Hyaluronan accumulates in rapidly remodeling tissues, such
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.