Direkt zum Inhalt
Merck

EHU153561

Sigma-Aldrich

MISSION® esiRNA

targeting human COL1A1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTCCTGGCAAAGATGGACTCAACGGTCTCCCTGGCCCCATTGGGCCCCCTGGTCCTCGCGGTCGCACTGGTGATGCTGGTCCTGTTGGTCCCCCCGGCCCTCCTGGACCTCCTGGTCCCCCTGGTCCTCCCAGCGCTGGTTTCGACTTCAGCTTCCTGCCCCAGCCACCTCAAGAGAAGGCTCACGATGGTGGCCGCTACTACCGGGCTGATGATGCCAATGTGGTTCGTGACCGTGACCTCGAGGTGGACACCACCCTCAAGAGCCTGAGCCAGCAGATCGAGAACATCCGGAGCCCAGAGGGCAGCCGCAAGAACCCCGCCCGCACCTGCCGTGACCTCAAGATGTGCCACTCTGACTGGAAGAGTGGAGAGTACTGGATTGACCCCAACCAAGGCTGCAACCTGGATGCCATCAAAGTCTTCTGCAACATGGAGACTGGTGAGACCTGCGTGTACCCCACTCAGCCCAGTGTGGCCCAGAAGAACTGGTACATCAGCAAGAACCCCAAGGACAAGAGGCATGTCTGGTTCGGCGAGAGCATGACCGATGGATT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jing Liu et al.
Discovery medicine, 25(139), 211-223 (2018-06-16)
Extracellular matrix (ECM) is an important component of tumor microenvironment and plays critical roles in cancer development and metastasis, in which collagen is the major structural protein. Collagen type I alpha 1 (COL1A1) is reportedly associated with the development of
Zheying Zhang et al.
International journal of oncology, 53(5), 1869-1880 (2018-08-23)
Colorectal cancer (CRC) treatment primarily relies on chemotherapy along with surgery, radiotherapy and, more recently, targeted therapy at the late stages. However, chemotherapeutic drugs have high cytotoxicity, and the similarity between the effects of these drugs on cancerous and healthy
Gennaro Di Maro et al.
The Journal of clinical endocrinology and metabolism, 99(9), E1617-E1626 (2014-05-23)
Anaplastic thyroid carcinoma (ATC) is one of the most aggressive human tumors. Twist1 is a basic helix-loop-helix transcription factor involved in cancer development and progression. We showed that Twist1 affects thyroid cancer cell survival and motility. We aimed to identify
Catherine M Willis et al.
PloS one, 9(8), e103966-e103966 (2014-08-05)
Expression of the glycosaminoglycan chondroitin sulfate-E (CS-E) is misregulated in many human cancers, including breast cancer. Cell-surface associated CS-E has been shown to have pro-tumorigenic functions, and pharmacological treatment with exogenous CS-E has been proposed to interfere with tumor progression

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.