Direkt zum Inhalt
Merck

EHU149061

Sigma-Aldrich

MISSION® esiRNA

targeting human KDM8

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTTGAAGCAGGACATCAGCATCCCCGACTACTGCAGCCTGGGCGATGGGGAGGAGGAGGAAATCACCATCAATGCCTGGTTTGGTCCCCAGGGAACCATCTCCCCACTACATCAGGATCCCCAGCAAAACTTCCTAGTGCAGGTGATGGGGAGGAAGTACATCCGGCTGTATTCCCCGCAGGAGTCAGGGGCTCTGTACCCTCATGACACGCACCTTCTCCATAACACGAGCCAGGTTGACGTGGAGAATCCCGACCTGGAAAAGTTCCCCAAGTTTGCCAAGGCCCCATTCCTGTCCTGCATCCTGTCTCCTGGAGAGATCCTGTTCATCCCGGTGAAATACTGGCATTACGTGCGGGCTCTGGATTTGAGCTTCTCGGTCAGCTTCTGGTGGTCGTAGCCAGGATAGGAGCTGAAAGGGCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Biochem./physiol. Wirkung

JMJD5 (jumonji domain-containing protein 5) exhibits histone H3 lysine 36 dimethylation (H3K36me2) demethylase activity and thereby is associated with gene transcription regulation. In addition, it also has hydroxylase activity and controls osteoclastogenesis. It is linked with cell cycle progression in breast cancer cells, chromosome segregation with the help of RCCD1 (RCC1 domain-containing protein 1), metabolism by controlling PKM2 (pyruvate kinase muscle isozyme) nuclear translocation, microtubule stability and mitotic progression. It also participates in HBV (Hepatitis B virus) replication.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

JMJD5 (Jumonji Domain-containing 5) Associates with Spindle Microtubules and Is Required for Proper Mitosis.
He Z
The Journal of Biological Chemistry, 291, 4684-4684 (2016)
Takahisa Kouwaki et al.
Journal of virology, 90(7), 3530-3542 (2016-01-23)
Hepatitis B virus (HBV) is a causative agent for chronic liver diseases such as hepatitis, cirrhosis, and hepatocellular carcinoma (HCC). HBx protein encoded by the HBV genome plays crucial roles not only in pathogenesis but also in replication of HBV.
Ru Zhang et al.
International journal of clinical and experimental pathology, 8(6), 6482-6489 (2015-08-12)
To observe the effects of Jumonji C domain-containing (JMJD) 5 depletion on colon cancer (CC). A short-hairpin RNA targeting JMJD5 was transfected into a lentivirus to make Lv-shJMJD5 for infection into the Caco-2 human cell. Besides, a negative control shRNA
Jing Shen et al.
EMBO reports, 18(12), 2131-2143 (2017-10-07)
The histone H3 N-terminal protein domain (N-tail) is regulated by multiple posttranslational modifications, including methylation, acetylation, phosphorylation, and by proteolytic cleavage. However, the mechanism underlying H3 N-tail proteolytic cleavage is largely elusive. Here, we report that JMJD5, a Jumonji C

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.