Direkt zum Inhalt
Merck

EHU147091

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGGTGACCTCGATCCTGAGATTGTAAAGTCATTCCTCTTCCAGCTACTAAAAGGGCTGGGATTCTGTCATAGCCGCAATGTGCTACACAGGGACCTGAAGCCCCAGAACCTGCTAATAAACAGGAATGGGGAGCTGAAATTGGCTGATTTTGGCCTGGCTCGAGCCTTTGGGATTCCCGTCCGCTGTTACTCAGCTGAGGTGGTCACACTGTGGTACCGCCCACCGGATGTCCTCTTTGGGGCCAAGCTGTACTCCACGTCCATCGACATGTGGTCAGCCGGCTGCATCTTTGCAGAGCTGGCCAATGCTGGGCGGCCTCTTTTTCCCGGCAATGATGTCGATGACCACTTGATCCTTGACTCCGTGGACACACTGCTGGGGACGCCCACCGAGGAGCAGTGGCCCTCTATGAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jie Zeng et al.
Journal of Cancer, 9(21), 3950-3961 (2018-11-10)
Cyclin-dependent kinase 5 (CDK5), an atypical member of the cyclin-dependent kinase family, plays an important role in the nervous system. Recent studies have shown that CDK5 is also associated with tumors. However, few studies have been done to investigate the
Hailong Tang et al.
International journal of molecular medicine, 45(6), 1661-1672 (2020-04-03)
The emergence of new drugs is a major feature of the treatment history of multiple myeloma (MM), which also reflects the current incurability of MM. As a unique member of cyclin dependent kinase (CDK) family, CDK5 participates in numerous tumorigenic
Johanna Liebl et al.
Nature communications, 6, 7274-7274 (2015-06-02)
The lymphatic system maintains tissue fluid balance, and dysfunction of lymphatic vessels and valves causes human lymphedema syndromes. Yet, our knowledge of the molecular mechanisms underlying lymphatic vessel development is still limited. Here, we show that cyclin-dependent kinase 5 (Cdk5)
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it
Shu Zhang et al.
PloS one, 10(7), e0131833-e0131833 (2015-07-07)
Cyclin-dependent kinase 5 (CDK5) is a cytoplasmic serine/ threonine kinase. Knockdown of CDK5 enhances paclitaxel sensitivity in human ovarian cancer cells. This study explores the mechanisms by which CDK5 regulates paclitaxel sensitivity in human ovarian cancers. Multiple ovarian cancer cell

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.