Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU144891

Sigma-Aldrich

MISSION® esiRNA

targeting human EFNB2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGGGTGTTTTGATGGTTTTATGCAGAACTGCGATTTCCAAATCGATAGTTTTAGAGCCTATCTATTGGAATTCCTCGAACTCCAAATTTCTACCTGGACAAGGACTGGTACTATACCCACAGATAGGAGACAAATTGGATATTATTTGCCCCAAAGTGGACTCTAAAACTGTTGGCCAGTATGAATATTATAAAGTTTATATGGTTGATAAAGACCAAGCAGACAGATGCACTATTAAGAAGGAAAATACCCCTCTCCTCAACTGTGCCAAACCAGACCAAGATATCAAATTCACCATCAAGTTTCAAGAATTCAGCCCTAACCTCTGGGGTCTAGAATTTCAGAAGAACAAAGATTATTACATTATATCTACATCAAATGGGTCTTTGGAGGGCCTGGATAACCAGGAGGGAGGGGTGTGCCAGACAAGAGCCATGAAGATCCTCATGAAAGTTGGACAAGATGCAAGTTCTGCTGG

Ensembl | Human Hinterlegungsnummer

ENSG00000125266

NCBI-Hinterlegungsnummer

NM_004093

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... EFNB2(1948) , EFNB2(1948)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Maha Coucha et al.
PloS one, 14(1), e0210523-e0210523 (2019-01-09)
We have previously shown that diabetes causes dysfunctional cerebral neovascularization that increases the risk for cerebrovascular disorders such as stroke and cognitive impairment. Pericytes (PCs) play a pivotal role in the angiogenic process through their interaction with the endothelial cells
Feng Zhu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 125, 109972-109972 (2020-02-10)
Ephrin-2 (EFNB2) is expressed at abnormally high levels in some neoplasms, such as squamous cell carcinoma of the head and neck and colorectal cancer. Its overexpression is associated with the malignant progression of tumors. However, the expression of EFNB2 in
Shilpa Bhatia et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4539-4550 (2018-06-01)
Purpose: The clinical success of targeted therapies such as cetuximab and radiotherapy (RT) is hampered by the low response rates and development of therapeutic resistance. In the current study, we investigated the involvement of EphB4-ephrin-B2 protumorigenic signaling in mediating resistance
Eri Sasabe et al.
PloS one, 12(11), e0188965-e0188965 (2017-12-01)
Oral squamous cell carcinoma (OSCC) is a common malignant tumor of the head and neck and frequently metastasizes to cervical lymph nodes. Aggressive local invasion and metastasis of OSCC are significant factors for poor prognosis. In this study, we investigated
Yan Hu et al.
Neuroscience bulletin, 30(3), 425-432 (2014-01-31)
Postmitotic neurons in the neocortex migrate to appropriate positions and form layered structures of nascent cortex during brain development. The migration of these neurons requires precise control and coordination of a large number of molecules such as axon guidance cues.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.