Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU140771

Sigma-Aldrich

MISSION® esiRNA

targeting human ANO1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GATGCCGACGAAGAAGATGTACCACATTAATGAGACCCGTGGCCTCCTGAAAAAAATCAACTCTGTGCTCCAGAAAATCACAGATCCCATCCAGCCCAAAGTGGCTGAGCACAGGCCCCAGACCATGAAGAGACTCTCCTATCCCTTCTCCCGGGAGAAGCAGCATCTATTTGACTTGTCTGATAAGGATTCCTTTTTCGACAGCAAAACCCGGAGCACGATTGTCTATGAGATCTTGAAGAGAACGACGTGTACAAAGGCCAAGTACAGCATGGGCATCACGAGCCTGCTGGCCAATGGTGTGTACGCGGCTGCATACCCACTGCACGATGGAGACTACAACGGTGAAAACGTCGAGTTCAACGACAGAAAACTCCTGTACGAAGAGTGGGCACGCTATGGAGTTTTCTATAAGTACCAGCCCATCGACC

Ensembl | Human Hinterlegungsnummer

ENSG00000131620

NCBI-Hinterlegungsnummer

NM_018043

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ANO1(55107) , ANO1(55107)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Chuantao Zhang et al.
International journal of clinical oncology, 25(6), 1145-1154 (2020-04-03)
Increase of the Ca2+-activated chloride channel TMEM16A is contribute to tumorigenesis. However, the expression level of TMEM16A and its underlying molecular mechanism for TMEM16Apromotingliver carcinogenesis is remains unknown. In the present study, the expression of TMEM16A in hepatocellular carcinoma (HCC)
Huan Lian et al.
Biochemical and biophysical research communications, 487(2), 201-208 (2017-04-11)
Diabetic nephropathy (DN) is one of the most common microvascular complication of diabetes mellitus (DM) as well as the main reason resulting in chronic renal failure. Transmembrane protein 16A (TMEM16A) plays an important role in multiple physiological actions. Here we
Hui Wang et al.
Cancer letters, 455, 48-59 (2019-05-03)
The Ca2+-activated chloride channel TMEM16A (anoctamin 1) is overexpressed in breast cancer. It remains unclear how TMEM16A overexpression plays a role in carcinogenesis in breast cancer. In this study, we found that high TMEM16A expression in combination with high EGFR
Shenbin Liu et al.
British journal of pharmacology, 173(7), 1208-1218 (2016-01-13)
TMEM16A, also known as anoctamin 1 channel, is a member of the Ca(2+)-activated chloride channels family and serves as a heat sensor in the primary nociceptors. Eact is a recently discovered small molecule activator of the TMEM16A channel. Here, we
Fanning Zeng et al.
PloS one, 7(10), e47686-e47686 (2012-11-08)
GPR39 is a GPCR implicated as a regulator of gastrointestinal motility, although the mechanism remains elusive. Here, we report that GPR39 is expressed by a specific cell population cultured from mouse small intestine muscle layers, which was subsequently identified as
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.