Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU140721

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATCCAGACGCTGTTTTCCTGCAAGAACCACAAGAAAGCCAAAGCCATTAAACTGATCCTTCTGGTGGTCATCGTGTTTTTCCTCTTCTGGACACCCTACAACGTTATGATTTTCCTGGAGACGCTTAAGCTCTATGACTTCTTTCCCAGTTGTGACATGAGGAAGGATCTGAGGCTGGCCCTCAGTGTGACTGAGACGGTTGCATTTAGCCATTGTTGCCTGAATCCTCTCATCTATGCATTTGCTGGGGAGAAGTTCAGAAGATACCTTTACCACCTGTATGGGAAATGCCTGGCTGTCCTGTGTGGGCGCTCAGTCCACGTTGATTTCTCCTCATCTGAATCACAAAGGAGCAGGCATGGAAGTGTTCTGAGCAGCAATTTTACTTACCACACGAGTGATGGAGATGCATTGCTCCTTCTCTGAAGGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000168329

NCBI-Hinterlegungsnummer

NM_001337

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CX3CR1(1524) , CX3CR1(1524)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lisa Rooper et al.
Journal of ovarian research, 6(1), 57-57 (2013-08-21)
The goal of this study was to determine a predominant cell type expressing fractalkine receptor (CX3CR1) in mature ovarian teratomas and to establish functional significance of its expression in cell differentiation. Specimens of ovarian teratoma and human fetal tissues were
Yoshimi Enose-Akahata et al.
Retrovirology, 9, 16-16 (2012-02-18)
The activation of mononuclear phagocytes (MPs), including monocytes, macrophages and dendritic cells, contributes to central nervous system inflammation in various neurological diseases. In HTLV-I-associated myelopathy/tropical spastic paraparesis (HAM/TSP), MPs are reservoirs of HTLV-I, and induce proinflammatory cytokines and excess T
Jun Tang et al.
Neuropharmacology, 119, 157-169 (2017-02-06)
Microglia play dual roles after germinal matrix hemorrhage, and the neurotrophic phenotype maybe neuroprotective. However, the phenotype transformation and the way by which neuron-microglia dialogue remain unclear. We raise the hypothesis that a cannabinoid receptor2 agonist (JWH133) accelerates the CX3CR1
Sheng-Mou Hou et al.
Arthritis research & therapy, 19(1), 282-282 (2017-12-23)
Osteoarthritis (OA) is a degenerative joint disease that affects the cartilage, synovium, and subchondral bone and is the leading cause of disability in older populations. Specific diagnostic biomarkers are lacking; hence, treatment options for OA are limited. Synovial inflammation is
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.