Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU136981

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAAGCAGCAGATCCAGAGGCAGATCCTCATCGCTGAGTTCCAGAGGCAGCACGAGCAGCTCTCCCGGCAGCACGAGGCGCAGCTCCACGAGCACATCAAGCAACAACAGGAGATGCTGGCCATGAAGCACCAGCAGGAGCTGCTGGAACACCAGCGGAAGCTGGAGAGGCACCGCCAGGAGCAGGAGCTGGAGAAGCAGCACCGGGAGCAGAAGCTGCAGCAGCTCAAGAACAAGGAGAAGGGCAAAGAGAGTGCCGTGGCCAGCACAGAAGTGAAGATGAAGTTACAAGAATTTGTCCTCAATAAAAAGAAGGCGCTGGCCCACCGGAATCTGAACCACTGCATTTCCAGCGACCCTCGCTACTGGTACGGGAAAACGCAGCACAGTTCCCTTGACCAGAGTTCTCCACCCCAGAGCGGAGTGTCGACCTCCTATAACCACCCGGTCCTGGGAATGTACGACGCCAAAGATGACTTCCCTCTTAGGAAAACAGCTTCTGAACCGAATCTGAAATTACGGTCCAGGC

Ensembl | Human Hinterlegungsnummer

ENSG00000068024

NCBI-Hinterlegungsnummer

NM_006037

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... HDAC4(9759) , HDAC4(9759)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

GuoLiang Zou et al.
Biochimie, 165, 90-99 (2019-05-13)
The cardioprotection of catalpol and its mechanism in diabetic cardiomyopathy (DCM) remains unclear. Here, mouse cardiomyocytes were treated with high glucose (HG) to establish a model of cellular injury induced by HG. In vitro experiments were carried out and confirmed that
Ling X Zhang et al.
American journal of physiology. Cell physiology, 307(4), C358-C372 (2014-06-20)
We have recently shown that in vivo inhibition of histone deacetylase (HDAC) stimulates endogenous myocardial regeneration in infarcted hearts (Zhang L et al. J Pharmacol Exp Ther 341: 285-293, 2012). Furthermore, our observation demonstrates that HDAC inhibition promotes cardiogenesis, which
Todd J Cohen et al.
Molecules and cells, 38(4), 343-348 (2015-03-03)
Fiber type-specific programs controlled by the transcription factor MEF2 dictate muscle functionality. Here, we show that HDAC4, a potent MEF2 inhibitor, is predominantly localized to the nuclei in fast/glycolytic fibers in contrast to the sarcoplasm in slow/oxidative fibers. The cytoplasmic
Y Yang et al.
Oncogene, 30(19), 2207-2218 (2011-01-19)
The transcriptional activity of the androgen receptor (AR) is regulated by both ligand binding and post-translational modifications, including acetylation and small ubiquitin-like modifier (SUMO)ylation. Histone deacetylases (HDACs) are known to catalyze the removal of acetyl groups from both histones and
Jung-Won Lee et al.
Nature communications, 10(1), 1897-1897 (2019-04-25)
The cellular decision regarding whether to undergo proliferation or death is made at the restriction (R)-point, which is disrupted in nearly all tumors. The identity of the molecular mechanisms that govern the R-point decision is one of the fundamental issues
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.