Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU136211

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTGAGGGCACATGCAGTAGATATTAATGGAAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGACAACAGACCTGAGTTCTTACACCAGGTTTGGAATGGGACAGTTCCTGAGGGATCAAAGCCTGGAACATATGTGATGACCGTAACAGCAATTGATGCTGACGATCCCAATGCCCTCAATGGGATGTTGAGGTACAGAATCGTGTCTCAGGCTCCAAGCACCCCTTCACCCAACATGTTTACAATCAACAATGAGACTGGTGACATCATCACAGTGGCAGCTGGACTTGATCGAGAAAAAGTGCAACAGTATACGTTAATAATTCAAGCTACAGACATGGAAGGCAATCCCACATATGGCCTTTCAAACACAGCCACGGCCGTCATCACAGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACGTTTTATGGTGAAGTTCCTGAGAACAGGGTAGACATCATAGTAGCTAATCTAACTGTGACCGATAAGGATCAACCCCATACACCA

Ensembl | Human Hinterlegungsnummer

ENSG00000170558

NCBI-Hinterlegungsnummer

NM_001792

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CDH2(1000) , CDH2(1000)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hsien-Ming Wu et al.
Oncotarget, 8(3), 4410-4421 (2016-12-30)
More than 25% of patients diagnosed with endometrial carcinoma have invasive primary cancer accompanied by metastases. Growth hormone-releasing hormone (GHRH) plays an important role in reproduction. Here, we examined the effect of a GHRH antagonist on the motility of endometrial
Bo Xu et al.
Nature biotechnology (2018-11-27)
The efficacy of oncolytic herpes simplex virus (oHSV) is limited by rapid viral clearance by innate immune effector cells and poor intratumoral viral spread. We combine two approaches to overcome these barriers: inhibition of natural killer (NK) cells and enhancement
Ciqing Yang et al.
Histochemistry and cell biology, 151(3), 239-248 (2018-09-27)
N-cadherin, a member of the cadherin family, plays an important role in neural development. In addition, N-cadherin has been reported to be crucial in neuronal migration, axonal outgrowth, and axonal path-finding. However, the mechanism underlying the effects of N-cadherin in
Srikanth R Polusani et al.
Journal of cell science, 129(23), 4399-4410 (2016-11-02)
Gap junction proteins (connexins) have crucial effects on cell motility in many systems, from migration of neural crest cells to promotion of metastatic invasiveness. Here, we show that expression of Cx26 (also known as GJB2) in HeLa cells specifically enhances
Ciqing Yang et al.
Journal of molecular histology, 47(6), 541-554 (2016-09-22)
N-cadherin is a calcium-sensitive cell adhesion molecule that plays an important role in the formation of the neural circuit and the development of the nervous system. In the present study, we investigated the function of N-cadherin in cell-cell connection in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.